Transcript: Mouse XM_017318409.2

PREDICTED: Mus musculus midline 1 (Mid1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Mid1 (17318)
Length:
4475
CDS:
846..2888

Additional Resources:

NCBI RefSeq record:
XM_017318409.2
NBCI Gene record:
Mid1 (17318)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318409.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238209 AGCCGTCTTGAGCCTAATAAG pLKO_005 3600 3UTR 100% 13.200 18.480 N Mid1 n/a
2 TRCN0000039519 CCAGGTCCTAATTCCCGAAAT pLKO.1 1883 CDS 100% 10.800 15.120 N Mid1 n/a
3 TRCN0000238213 GACCAACAGTCAGCCGTTTAG pLKO_005 2324 CDS 100% 10.800 15.120 N Mid1 n/a
4 TRCN0000238211 TGATCAGGCTCCGCAAGTTAG pLKO_005 1711 CDS 100% 10.800 15.120 N Mid1 n/a
5 TRCN0000039523 CGGAAGCACATGGTACGCCAT pLKO.1 2528 CDS 100% 0.720 1.008 N Mid1 n/a
6 TRCN0000238210 TTCAGCAACGAAGACAAATTA pLKO_005 1663 CDS 100% 15.000 10.500 N Mid1 n/a
7 TRCN0000238212 ATGTGATCTTCTCATTGAAAT pLKO_005 1640 CDS 100% 13.200 9.240 N Mid1 n/a
8 TRCN0000236058 TGTGACCGATGACCAGTTAAT pLKO_005 1406 CDS 100% 13.200 9.240 N MID1 n/a
9 TRCN0000019812 GCTATGACAAATTGAAGCAAA pLKO.1 1489 CDS 100% 4.950 3.465 N MID1 n/a
10 TRCN0000039522 CAAGTATATCTTCACGGTGAA pLKO.1 2255 CDS 100% 4.050 2.835 N Mid1 n/a
11 TRCN0000039521 CATCCGAACAAGAAGCCCTTT pLKO.1 1293 CDS 100% 4.050 2.835 N Mid1 n/a
12 TRCN0000019811 CCATCGTCTGATTGAGCCAAT pLKO.1 1319 CDS 100% 4.050 2.835 N MID1 n/a
13 TRCN0000039520 GTCCTATTTGTCTGGAGCTTT pLKO.1 874 CDS 100% 4.950 2.970 N Mid1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318409.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01012 pDONR223 100% 87.1% 93.3% None (many diffs) n/a
2 ccsbBroad304_01012 pLX_304 0% 87.1% 93.3% V5 (many diffs) n/a
3 TRCN0000475513 CACTGTGGAATTACTCCATAACCA pLX_317 16% 87.1% 93.3% V5 (many diffs) n/a
Download CSV