Construct: ORF TRCN0000475577
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006442.1_s317c1
- Derived from:
- ccsbBroadEn_00299
- DNA Barcode:
- CGCTTACTTGGATGATGCTCAATC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RCBTB2 (1102)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475577
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1102 | RCBTB2 | RCC1 and BTB domain contain... | NM_001268.4 | 100% | 100% | |
| 2 | human | 1102 | RCBTB2 | RCC1 and BTB domain contain... | NM_001352424.2 | 100% | 100% | |
| 3 | human | 1102 | RCBTB2 | RCC1 and BTB domain contain... | NM_001352425.2 | 100% | 100% | |
| 4 | human | 1102 | RCBTB2 | RCC1 and BTB domain contain... | NM_001352429.2 | 97.9% | 96% | (many diffs) |
| 5 | human | 1102 | RCBTB2 | RCC1 and BTB domain contain... | XM_017020369.1 | 97% | 96.6% | (many diffs) |
| 6 | human | 1102 | RCBTB2 | RCC1 and BTB domain contain... | XM_017020370.1 | 97% | 96.6% | (many diffs) |
| 7 | human | 1102 | RCBTB2 | RCC1 and BTB domain contain... | NM_001286830.1 | 97% | 95.9% | (many diffs) |
| 8 | human | 1102 | RCBTB2 | RCC1 and BTB domain contain... | XM_011534894.3 | 97% | 95.9% | (many diffs) |
| 9 | human | 1102 | RCBTB2 | RCC1 and BTB domain contain... | XM_017020371.2 | 97% | 95.9% | (many diffs) |
| 10 | human | 1102 | RCBTB2 | RCC1 and BTB domain contain... | XM_017020372.1 | 97% | 95.9% | (many diffs) |
| 11 | human | 1102 | RCBTB2 | RCC1 and BTB domain contain... | NM_001286831.1 | 95.6% | 95.6% | 0_1ins72 |
| 12 | human | 1102 | RCBTB2 | RCC1 and BTB domain contain... | NM_001352426.2 | 95.6% | 95.6% | 0_1ins72 |
| 13 | human | 1102 | RCBTB2 | RCC1 and BTB domain contain... | XR_941470.2 | 69.2% | (many diffs) | |
| 14 | human | 1102 | RCBTB2 | RCC1 and BTB domain contain... | XM_017020374.1 | 55.3% | 54.2% | (many diffs) |
| 15 | human | 1102 | RCBTB2 | RCC1 and BTB domain contain... | XM_017020375.1 | 55.3% | 54.2% | (many diffs) |
| 16 | human | 1102 | RCBTB2 | RCC1 and BTB domain contain... | XM_017020376.1 | 54.7% | 53.6% | (many diffs) |
| 17 | human | 1102 | RCBTB2 | RCC1 and BTB domain contain... | NR_147985.2 | 54.3% | (many diffs) | |
| 18 | human | 1102 | RCBTB2 | RCC1 and BTB domain contain... | NM_001352431.1 | 51.5% | 45.7% | (many diffs) |
| 19 | human | 1102 | RCBTB2 | RCC1 and BTB domain contain... | NM_001286832.1 | 50.2% | 44.6% | 0_1ins679;103_104ins143 |
| 20 | human | 1102 | RCBTB2 | RCC1 and BTB domain contain... | NM_001352427.2 | 50.2% | 44.6% | 0_1ins679;103_104ins143 |
| 21 | human | 1102 | RCBTB2 | RCC1 and BTB domain contain... | NM_001352428.2 | 50.2% | 44.6% | 0_1ins679;103_104ins143 |
| 22 | human | 1102 | RCBTB2 | RCC1 and BTB domain contain... | XM_017020379.1 | 50.2% | 44.6% | 0_1ins679;103_104ins143 |
| 23 | human | 1102 | RCBTB2 | RCC1 and BTB domain contain... | NM_001352430.1 | 49.4% | 42.9% | (many diffs) |
| 24 | human | 1102 | RCBTB2 | RCC1 and BTB domain contain... | XR_941471.2 | 49.2% | (many diffs) | |
| 25 | human | 1102 | RCBTB2 | RCC1 and BTB domain contain... | XM_017020377.1 | 46.6% | 44.6% | (many diffs) |
| 26 | human | 1102 | RCBTB2 | RCC1 and BTB domain contain... | XR_001749469.1 | 42.3% | (many diffs) | |
| 27 | mouse | 105670 | Rcbtb2 | regulator of chromosome con... | NM_001170694.1 | 89.2% | 95.2% | (many diffs) |
| 28 | mouse | 105670 | Rcbtb2 | regulator of chromosome con... | NM_134083.4 | 89.2% | 95.2% | (many diffs) |
| 29 | mouse | 105670 | Rcbtb2 | regulator of chromosome con... | XM_006518382.3 | 89.2% | 95.2% | (many diffs) |
| 30 | mouse | 105670 | Rcbtb2 | regulator of chromosome con... | XM_006518383.2 | 89.2% | 95.2% | (many diffs) |
| 31 | mouse | 105670 | Rcbtb2 | regulator of chromosome con... | XM_006518384.1 | 89.2% | 95.2% | (many diffs) |
| 32 | mouse | 105670 | Rcbtb2 | regulator of chromosome con... | XM_006518385.3 | 89.2% | 95.2% | (many diffs) |
| 33 | mouse | 105670 | Rcbtb2 | regulator of chromosome con... | XM_011244891.2 | 89.2% | 95.2% | (many diffs) |
| 34 | mouse | 105670 | Rcbtb2 | regulator of chromosome con... | XM_006518386.2 | 85.4% | 91.8% | (many diffs) |
| 35 | mouse | 105670 | Rcbtb2 | regulator of chromosome con... | XM_011244892.2 | 82.2% | 78.5% | (many diffs) |
| 36 | mouse | 105670 | Rcbtb2 | regulator of chromosome con... | XM_006518388.2 | 62.5% | 66.6% | (many diffs) |
| 37 | mouse | 105670 | Rcbtb2 | regulator of chromosome con... | NR_033185.1 | 38.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1719
- ORF length:
- 1653
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga agaagaactt cctcttttct ctggagacag tggcaagcca gtacaggcta 121 ctctgtcatc tttgaagatg ttagatgtgg gaaagtggcc aattttttcc ctttgttctg 181 aagaagaact acagttaatt cgtcaggctt gtgtctttgg cagtgctggc aatgaagttt 241 tatacactac agtaaatgat gagatttttg tgcttggcac aaactgctgt ggctgtttgg 301 ggttaggtga cgtccagagc accattgaac ctcggagact ggattcttta aatggcaaaa 361 aaatagcctg cctcagctat gggagtggtc cacatattgt ccttgcaaca acagaaggag 421 aagtctttac ctggggtcat aatgcttata gccagctggg caatgggaca actaatcatg 481 gtttagtgcc ctgtcatatc tctactaatc tgtcaaacaa acaagtcatt gaagttgcct 541 gtgggtctta ccattctttg gtgctaacat ctgatggaga ggtatttgcc tggggttata 601 ataactctgg gcaggtagga tctggatcaa cagttaatca gccaatccct cgaagagtca 661 ctggctgcct acaaaataaa gtagttgtga ccatagcatg tgggcagatg tgctgcatgg 721 cagtagtaga cacgggggag gtctatgtct ggggttacaa cggaaacggg cagcttggac 781 tcggcaacag tggcaaccag ccaacccctt gcagagtggc agctttgcaa ggcatccgtg 841 tccagagggt cgcctgtggc tacgcacaca cattagtatt aacagatgaa ggccaagtgt 901 atgcttgggg cgccaattct tatgggcagt tgggcactgg caataaaagc aaccagtcct 961 atcctactcc tgtcactgtg gaaaaggaca ggattatcga gattgcagcc tgtcactcca 1021 cacacacgtc tgcggccaag acgcagggtg ggcacgtgta catgtggggc cagtgccggg 1081 gtcagtccgt gatcctcccg cacctcaccc acttctcctg cactgacgac gtgtttgcct 1141 gctttgccac gcccgccgtc acgtggcgcc tcctctccgt ggaacctgat gaccacctca 1201 cagtggctga gtcactgaag agggaatttg acaacccgga cactgcagac ctgaagtttc 1261 tagttgatgg aaagtacatt tatgcacata aagtccttct caagattcga tgtgagcatt 1321 ttcgttcgtc attggaagat aacgaggatg atattgtaga aatgagtgaa ttttcatatc 1381 ctgtttaccg ggccttcctg gaatacctat acacagacag catcagcctt tctcctgagg 1441 aggcagtagg actgctagac ttggctacat tttatagaga aaatcgtttg aaaaagctct 1501 gccaacaaac tatcaagCAA GGCATCTGCG AGGAGAATGC CATCGCTCTG CTCTCGGCTG 1561 CGGTGAAGTA TGATGCACAG GATTTAGAAG AATTCTGCTT CAGGTTTTGC ATAAACCATC 1621 TGACTGTAGT AACACAAACA TCAGGTTTTG CAGAAATGGA CCATGATCTC CTGAAGAACT 1681 TTATCAGCAA AGCAAGCAGA GTTGGAGCCT TTAAAAATTG CCCAACTTTC TTGTACAAAG 1741 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1801 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1861 ACGACGCTTA CTTGGATGAT GCTCAATCAC GCGTTAAGTC gacaatcaac ctctggatta 1921 caaaatttgt gaaagatt