Transcript: Human NM_001286830.1

Homo sapiens RCC1 and BTB domain containing protein 2 (RCBTB2), transcript variant 1, mRNA.

Source:
NCBI, updated 2018-12-16
Taxon:
Homo sapiens (human)
Gene:
RCBTB2 (1102)
Length:
3215
CDS:
368..2038

Additional Resources:

NCBI RefSeq record:
NM_001286830.1
NBCI Gene record:
RCBTB2 (1102)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286830.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151907 CCCTGGCAATTAAATTGTCAA pLKO.1 2650 3UTR 100% 4.950 6.930 N RCBTB2 n/a
2 TRCN0000151594 GTATTAACAGATGAAGGCCAA pLKO.1 1193 CDS 100% 2.160 3.024 N RCBTB2 n/a
3 TRCN0000152592 GTGAAGTATGATGCACAGGAT pLKO.1 1880 CDS 100% 2.640 2.112 N RCBTB2 n/a
4 TRCN0000154627 CACAAACTGCTGTGGCTGTTT pLKO.1 595 CDS 100% 4.950 3.465 N RCBTB2 n/a
5 TRCN0000155938 CCCTGGTCTCAGTATATGCTA pLKO.1 2325 3UTR 100% 3.000 2.100 N RCBTB2 n/a
6 TRCN0000151756 CCTGAAGAACTTTATCAGCAA pLKO.1 1987 CDS 100% 2.640 1.848 N RCBTB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286830.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00299 pDONR223 100% 97% 95.9% None (many diffs) n/a
2 ccsbBroad304_00299 pLX_304 0% 97% 95.9% V5 (many diffs) n/a
3 TRCN0000475577 CGCTTACTTGGATGATGCTCAATC pLX_317 12.6% 97% 95.9% V5 (many diffs) n/a
Download CSV