Transcript: Mouse XM_006518383.2

PREDICTED: Mus musculus regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2 (Rcbtb2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rcbtb2 (105670)
Length:
3906
CDS:
795..2450

Additional Resources:

NCBI RefSeq record:
XM_006518383.2
NBCI Gene record:
Rcbtb2 (105670)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518383.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077426 CGAGCTTTCCTGGAGTATCTA pLKO.1 2118 CDS 100% 5.625 7.875 N Rcbtb2 n/a
2 TRCN0000311838 CGAGCTTTCCTGGAGTATCTA pLKO_005 2118 CDS 100% 5.625 7.875 N Rcbtb2 n/a
3 TRCN0000077424 CCCTGCCATATCTCTACGAAT pLKO.1 1218 CDS 100% 4.950 6.930 N Rcbtb2 n/a
4 TRCN0000311837 CCCTGCCATATCTCTACGAAT pLKO_005 1218 CDS 100% 4.950 6.930 N Rcbtb2 n/a
5 TRCN0000313123 GGCTCCAACTGGGTATGATAT pLKO_005 2678 3UTR 100% 13.200 9.240 N Rcbtb2 n/a
6 TRCN0000077423 GCCTCTAACATAGTACCTTAT pLKO.1 3238 3UTR 100% 10.800 7.560 N Rcbtb2 n/a
7 TRCN0000077427 GCTTGCAGAATAAAGTAGTTA pLKO.1 1396 CDS 100% 5.625 3.938 N Rcbtb2 n/a
8 TRCN0000311774 GCTTGCAGAATAAAGTAGTTA pLKO_005 1396 CDS 100% 5.625 3.938 N Rcbtb2 n/a
9 TRCN0000077425 GCAGAAATGGACCACGATCTT pLKO.1 2379 CDS 100% 4.950 3.465 N Rcbtb2 n/a
10 TRCN0000311776 GCAGAAATGGACCACGATCTT pLKO_005 2379 CDS 100% 4.950 3.465 N Rcbtb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518383.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00299 pDONR223 100% 89.2% 95.2% None (many diffs) n/a
2 ccsbBroad304_00299 pLX_304 0% 89.2% 95.2% V5 (many diffs) n/a
3 TRCN0000475577 CGCTTACTTGGATGATGCTCAATC pLX_317 12.6% 89.2% 95.2% V5 (many diffs) n/a
Download CSV