Construct: ORF TRCN0000475829
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013622.1_s317c1
- Derived from:
- ccsbBroadEn_01299
- DNA Barcode:
- AATCCTTTTAGAGGCTTGGACTGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PRPS2 (5634)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475829
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5634 | PRPS2 | phosphoribosyl pyrophosphat... | NM_002765.4 | 100% | 100% | |
| 2 | human | 5634 | PRPS2 | phosphoribosyl pyrophosphat... | NM_001039091.2 | 99% | 99% | 305_313delAGGTAGGAG |
| 3 | human | 5631 | PRPS1 | phosphoribosyl pyrophosphat... | NM_002764.4 | 79.8% | 95.2% | (many diffs) |
| 4 | human | 221823 | PRPS1L1 | phosphoribosyl pyrophosphat... | NM_175886.3 | 79.2% | 90.8% | (many diffs) |
| 5 | human | 5631 | PRPS1 | phosphoribosyl pyrophosphat... | NM_001204402.1 | 28.9% | 34.9% | (many diffs) |
| 6 | mouse | 110639 | Prps2 | phosphoribosyl pyrophosphat... | NM_026662.5 | 89% | 98.7% | (many diffs) |
| 7 | mouse | 110639 | Prps2 | phosphoribosyl pyrophosphat... | NM_001313758.1 | 88.2% | 97.8% | (many diffs) |
| 8 | mouse | 110639 | Prps2 | phosphoribosyl pyrophosphat... | XM_017318352.1 | 36.9% | 23.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1023
- ORF length:
- 954
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaataag 61 ttggcaccat gcccaacatc gtgctgttca gcggcagctc gcatcaggac ctgtcccagc 121 gcgtggccga ccgcctgggc ctggagctgg gcaaggtggt cacgaagaag ttcagcaacc 181 aggagaccag cgtggagatt ggtgaaagcg tgagagggga agatgtctac atcatccaga 241 gcggctgcgg ggaaattaac gacaacctga tggaactcct catcatgatc aatgcctgca 301 agattgcgtc atcatccaga gtaactgccg tgatcccgtg tttcccatac gcccgacaag 361 ataaaaagga caagagtcgt gccccaattt ctgcaaaact tgtggccaat atgctgtcgg 421 tggctggggc ggatcacatc atcaccatgg acctgcatgc ttctcagata cagggattct 481 ttgatattcc tgtggataat ttgtatgcgg agcccgcagt cctgcagtgg attcgggaaa 541 acattgccga gtggaagaac tgtatcattg tttcacctga cgcaggggga gccaaaaggg 601 ttacatcaat tgcagacagg ttgaatgtgg aatttgcttt gatccacaaa gagaggaaga 661 aggcgaatga agtggaccgg atggtcctgg tgggcgacgt gaaggaccgt gtggccatcc 721 TCGTGGATGA CATGGCTGAC ACTTGCGGCA CCATCTGCCA TGCTGCGGAC AAGCTGCTGT 781 CAGCTGGAGC CACCAAAGTG TATGCTATCC TTACCCATGG GATCTTCTCT GGACCAGCTA 841 TTTCCAGAAT AAATAATGCC GCCTTTGAGG CTGTTGTCGT CACAAACACA ATTCCGCAAG 901 AGGACAAAAT GAAACACTGC ACCAAGATTC AGGTCATTGA CATTTCCATG ATCTTGGCCG 961 AAGCAATCCG AAGGACACAC AATGGGGAAT CCGTGTCCTA CCTGTTCAGC CATGTCCCGC 1021 TATTGCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1081 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1141 GGCTTTATAT ATCTTGTGGA AAGGACGAAA TCCTTTTAGA GGCTTGGACT GCACGCGTTA 1201 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt