Transcript: Human NM_145811.3

Homo sapiens calcium voltage-gated channel auxiliary subunit gamma 5 (CACNG5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
CACNG5 (27091)
Length:
10576
CDS:
238..1065

Additional Resources:

NCBI RefSeq record:
NM_145811.3
NBCI Gene record:
CACNG5 (27091)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145811.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429334 ACAAGTATGGGTGGTCGTTTG pLKO_005 755 CDS 100% 6.000 8.400 N CACNG5 n/a
2 TRCN0000045137 CGGTCAATGTTCTAAAGATGA pLKO.1 506 CDS 100% 4.950 6.930 N CACNG5 n/a
3 TRCN0000045134 GCGTTGCTTCACCATAGAATA pLKO.1 447 CDS 100% 13.200 10.560 N CACNG5 n/a
4 TRCN0000045136 GCTCTACATCTCCAGCATCAA pLKO.1 687 CDS 100% 4.950 3.465 N CACNG5 n/a
5 TRCN0000428317 CTTCATGTTCATTGGGTTTAT pLKO_005 564 CDS 100% 13.200 7.920 N CACNG5 n/a
6 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 4183 3UTR 100% 4.950 2.475 Y ORAI2 n/a
7 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 5006 3UTR 100% 4.950 2.475 Y LOC387873 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4108 3UTR 100% 13.200 6.600 Y LIAS n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5043 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5043 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145811.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02994 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02994 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475930 ACAATACTGCATCTTCGATCAAAA pLX_317 34.9% 100% 100% V5 n/a
Download CSV