Construct: ORF TRCN0000475999
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009914.1_s317c1
- Derived from:
- ccsbBroadEn_00310
- DNA Barcode:
- ACAGAAGCTTTAATAAGAGGACTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CHRNB4 (1143)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475999
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 1143 | CHRNB4 | cholinergic receptor nicoti... | NM_000750.5 | 100% | 100% | |
2 | human | 1143 | CHRNB4 | cholinergic receptor nicoti... | XM_011521186.2 | 95.9% | 95.6% | (many diffs) |
3 | human | 1143 | CHRNB4 | cholinergic receptor nicoti... | XM_011521187.2 | 95.9% | 95.6% | (many diffs) |
4 | human | 1143 | CHRNB4 | cholinergic receptor nicoti... | XM_017021885.1 | 93.9% | 93.9% | 0_1ins90 |
5 | human | 1143 | CHRNB4 | cholinergic receptor nicoti... | XM_017021886.1 | 93.9% | 93.9% | 0_1ins90 |
6 | human | 1143 | CHRNB4 | cholinergic receptor nicoti... | XM_017021887.1 | 91.7% | 88.1% | (many diffs) |
7 | human | 1143 | CHRNB4 | cholinergic receptor nicoti... | XM_017021888.1 | 90.3% | 88.5% | (many diffs) |
8 | human | 1143 | CHRNB4 | cholinergic receptor nicoti... | XM_017021889.2 | 89.8% | 89.5% | (many diffs) |
9 | human | 1143 | CHRNB4 | cholinergic receptor nicoti... | XM_011521190.2 | 85.1% | 85.1% | 0_1ins222 |
10 | human | 1143 | CHRNB4 | cholinergic receptor nicoti... | XM_011521191.2 | 85.1% | 85.1% | 0_1ins222 |
11 | human | 1143 | CHRNB4 | cholinergic receptor nicoti... | XM_011521192.2 | 63.4% | 63.4% | 0_1ins546 |
12 | mouse | 108015 | Chrnb4 | cholinergic receptor, nicot... | NM_148944.4 | 83% | 82.2% | (many diffs) |
13 | mouse | 108015 | Chrnb4 | cholinergic receptor, nicot... | XM_006510757.3 | 78.9% | 78.6% | (many diffs) |
14 | mouse | 108015 | Chrnb4 | cholinergic receptor, nicot... | XM_011242655.2 | 78.9% | 78.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1563
- ORF length:
- 1494
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaggcgcgcg ccttccctgg tccttttctt cctggtcgcc ctttgcgggc 121 gcgggaactg ccgcgtggcc aatgcggagg aaaagctgat ggacgacctt ctgaacaaaa 181 cccgttacaa taacctgatc cgcccagcca ccagctcctc acagctcatc tccatcaagc 241 tgcagctctc cctggcccag cttatcagcg tgaatgagcg agagcagatc atgaccacca 301 atgtctggct gaaacaggaa tggactgatt accgcctgac ctggaacagc tcccgctacg 361 agggtgtgaa catcctgagg atccctgcaa agcgcatctg gttgcctgac atcgtgcttt 421 acaacaacgc cgacgggacc tatgaggtgt ctgtctacac caacttgata gtccggtcca 481 acggcagcgt cctgtggctg ccccctgcca tctacaagag cgcctgcaag attgaggtga 541 agtactttcc cttcgaccag cagaactgca ccctcaagtt ccgctcctgg acctatgacc 601 acacggagat agacatggtc ctcatgacgc ccacagccag catggatgac tttactccca 661 gtggtgagtg ggacatagtg gccctcccag ggagaaggac agtgaaccca caagacccca 721 gctacgtgga cgtgacttac gacttcatca tcaagcgcaa gcctctgttc tacaccatca 781 acctcatcat cccctgcgtg ctcaccacct tgctggccat cctcgtcttc tacctgccat 841 ccgactgcgg cgagaagatg acactgtgca tctcagtgct gctggcactg acattcttcc 901 tgctgctcat ctccaagatc gtgccaccca cctccctcga tgtgcctctc atcggcaagt 961 acctcatgtt caccatggtg ctggtcacct tctccatcgt caccagcgtc tgtgtgctca 1021 atgtgcacca ccgctcgccc agcacccaca ccatggcacc ctgggtcaag cgctgcttcc 1081 tgcacaagct gcctaccttc ctcttcatga agcgccctgg ccccgacagc agcccggcca 1141 gagccTTCCC GCCCAGCAAG TCATGCGTGA CCAAGCCCGA GGCCACCGCC ACCTCCACCA 1201 GCCCCTCCAA CTTCTATGGG AACTCCATGT ACTTTGTGAA CCCCGCCTCT GCAGCTTCCA 1261 AGTCTCCAGC CGGCTCTACC CCGGTGGCTA TCCCCAGGGA TTTCTGGCTG CGGTCCTCTG 1321 GGAGGTTCCG ACAGGATGTG CAGGAGGCAT TAGAAGGTGT CAGCTTCATC GCCCAGCACA 1381 TGAAGAATGA CGATGAAGAC CAGAGTGTCG TTGAGGACTG GAAGTACGTG GCTATGGTGG 1441 TGGACCGGCT GTTCCTGTGG GTGTTCATGT TTGTGTGCGT CCTGGGCACT GTGGGGCTCT 1501 TCCTACCGCC CCTCTTCCAG ACCCATGCAG CTTCTGAGGG GCCCTACGCT GCCCAGCGTG 1561 ACTTGCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1621 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1681 GGCTTTATAT ATCTTGTGGA AAGGACGAAC AGAAGCTTTA ATAAGAGGAC TTACGCGTTA 1741 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt