Transcript: Mouse XM_011242655.2

PREDICTED: Mus musculus cholinergic receptor, nicotinic, beta polypeptide 4 (Chrnb4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Chrnb4 (108015)
Length:
2775
CDS:
603..2003

Additional Resources:

NCBI RefSeq record:
XM_011242655.2
NBCI Gene record:
Chrnb4 (108015)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242655.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432846 TAGATTCCCTGGCCGTCTTTC pLKO_005 2352 3UTR 100% 10.800 15.120 N Chrnb4 n/a
2 TRCN0000432743 GCTAATGAGACCCTAAGTAAA pLKO_005 2090 3UTR 100% 13.200 10.560 N Chrnb4 n/a
3 TRCN0000102994 GTCTGTCTACACCAACGTGAT pLKO.1 893 CDS 100% 4.050 3.240 N Chrnb4 n/a
4 TRCN0000426169 CTCTGAATATCTTCGAGTAAG pLKO_005 2183 3UTR 100% 10.800 7.560 N Chrnb4 n/a
5 TRCN0000102993 CATTGGCAAGTACCTCTTGTT pLKO.1 1394 CDS 100% 4.950 3.465 N Chrnb4 n/a
6 TRCN0000102991 GAAACAGGAATGGACTGACTA pLKO.1 755 CDS 100% 4.950 3.465 N Chrnb4 n/a
7 TRCN0000102990 CCATCCAACCTCTATGGGAAT pLKO.1 1659 CDS 100% 4.050 2.835 N Chrnb4 n/a
8 TRCN0000102992 CCACACAGAGATTGACATGGT pLKO.1 1043 CDS 100% 2.640 1.848 N Chrnb4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242655.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00310 pDONR223 100% 78.9% 78.6% None (many diffs) n/a
2 ccsbBroad304_00310 pLX_304 0% 78.9% 78.6% V5 (many diffs) n/a
3 TRCN0000475999 ACAGAAGCTTTAATAAGAGGACTT pLX_317 28.2% 78.9% 78.6% V5 (many diffs) n/a
Download CSV