Transcript: Human NM_198219.3

Homo sapiens inhibitor of growth family member 1 (ING1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-15
Taxon:
Homo sapiens (human)
Gene:
ING1 (3621)
Length:
4697
CDS:
451..1290

Additional Resources:

NCBI RefSeq record:
NM_198219.3
NBCI Gene record:
ING1 (3621)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198219.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073268 GCCATGATGTATATCCATATA pLKO.1 1722 3UTR 100% 13.200 10.560 N ING1 n/a
2 TRCN0000232658 TTGTTCCTCTAGTAGTATATT pLKO_005 2129 3UTR 100% 15.000 10.500 N ING1 n/a
3 TRCN0000232656 ACGAGAAGACCATGGACAAAG pLKO_005 1229 CDS 100% 10.800 7.560 N ING1 n/a
4 TRCN0000073271 CAATCATAAACCCAAGGGCAA pLKO.1 1179 CDS 100% 2.160 1.512 N ING1 n/a
5 TRCN0000232657 GGGCTTACAACAGGTAGTTTG pLKO_005 1274 CDS 100% 10.800 6.480 N ING1 n/a
6 TRCN0000232655 CCATCGAGTGGTTCCACTTCT pLKO_005 1145 CDS 100% 4.950 2.970 N ING1 n/a
7 TRCN0000088082 CTGGTGAACTATGTGGAGGAT pLKO.1 484 CDS 100% 2.640 1.848 N Ing1 n/a
8 TRCN0000162795 CTTCCAAAGTGCTGGGATTAT pLKO.1 2875 3UTR 100% 13.200 6.600 Y SLC48A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198219.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00869 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00869 pLX_304 2.9% 100% 100% V5 n/a
3 TRCN0000476009 GTATCTAACTCTTTTTTGAATTCG pLX_317 38.6% 100% 100% V5 n/a
4 ccsbBroadEn_10236 pDONR223 100% 13.2% 10.7% None (many diffs) n/a
5 ccsbBroad304_10236 pLX_304 0% 13.2% 10.7% V5 (many diffs) n/a
6 TRCN0000471757 ATGGTTAGTAAGAGCCTCTAAGAA pLX_317 100% 13.2% 10.7% V5 (many diffs) n/a
Download CSV