Transcript: Human NR_002226.3

Homo sapiens inhibitor of growth family, X-linked (pseudogene) (INGX), non-coding RNA.

Source:
NCBI, updated 2018-05-25
Taxon:
Homo sapiens (human)
Gene:
INGX (27160)
Length:
769
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_002226.3
NBCI Gene record:
INGX (27160)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_002226.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 505 3UTR 100% 4.950 2.475 Y ERAP2 n/a
2 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 506 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_002226.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00869 pDONR223 100% 25.6% None (many diffs) n/a
2 ccsbBroad304_00869 pLX_304 2.9% 25.6% V5 (many diffs) n/a
3 TRCN0000476009 GTATCTAACTCTTTTTTGAATTCG pLX_317 38.6% 25.6% V5 (many diffs) n/a
4 ccsbBroadEn_10236 pDONR223 100% 16.3% None 1_202del;329_769del n/a
5 ccsbBroad304_10236 pLX_304 0% 16.3% V5 1_202del;329_769del n/a
6 TRCN0000471757 ATGGTTAGTAAGAGCCTCTAAGAA pLX_317 100% 16.3% V5 1_202del;329_769del n/a
Download CSV