Construct: ORF TRCN0000476079
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001306.4_s317c1
- Derived from:
- ccsbBroadEn_00944
- DNA Barcode:
- ACTATAGCACACTGAAGGTTTGAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LIMK2 (3985)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476079
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3985 | LIMK2 | LIM domain kinase 2 | NM_001031801.2 | 100% | 100% | |
| 2 | human | 3985 | LIMK2 | LIM domain kinase 2 | NM_016733.3 | 87.6% | 78.3% | (many diffs) |
| 3 | human | 3985 | LIMK2 | LIM domain kinase 2 | NM_005569.4 | 83.9% | 74.3% | (many diffs) |
| 4 | human | 26472 | PPP1R14B | protein phosphatase 1 regul... | NM_138689.3 | 18.9% | 15.5% | (many diffs) |
| 5 | mouse | 16886 | Limk2 | LIM motif-containing protei... | NM_173053.1 | 78.3% | 74.6% | (many diffs) |
| 6 | mouse | 16886 | Limk2 | LIM motif-containing protei... | XM_006514550.3 | 77.6% | 74% | (many diffs) |
| 7 | mouse | 16886 | Limk2 | LIM motif-containing protei... | NM_010718.4 | 75.4% | 71.3% | (many diffs) |
| 8 | mouse | 16886 | Limk2 | LIM motif-containing protei... | XM_006514548.2 | 74.8% | 70.8% | (many diffs) |
| 9 | mouse | 16886 | Limk2 | LIM motif-containing protei... | XM_011243666.2 | 70.1% | 66.8% | (many diffs) |
| 10 | mouse | 16886 | Limk2 | LIM motif-containing protei... | XM_006514547.1 | 69.6% | 66.2% | (many diffs) |
| 11 | mouse | 16886 | Limk2 | LIM motif-containing protei... | NM_001034030.2 | 56.8% | 53.1% | (many diffs) |
| 12 | mouse | 16886 | Limk2 | LIM motif-containing protei... | XM_006514552.3 | 56.3% | 52.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2124
- ORF length:
- 2058
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg gagttacttg tcagtcccgg cttacttcac ctccagagac ctgtttcggt 121 gttcagaatg ccaggattcc ctcaccaact ggtactatga gaaggatggg aagctctact 181 gccccaagga ctactggggg aagtttgggg agttctgtca tgggtgctcc ctgctgatga 241 cagggccttt tatggtggct ggggagttca agtaccaccc agagtgcttt gcctgtatga 301 gctgcaaggt gatcattgag gatggggatg catatgcact ggtgcagcat gccaccctct 361 actgtgggaa gtgccacaat gaggtggtgc tggcacccat gtttgagaga ctctccacag 421 agtctgttca ggagcagctg ccctactctg tcacgctcat ctccatgccg gccaccactg 481 aaggcaggcg gggcttctcc gtgtccgtgg agagtgcctg ctccaactac gccaccactg 541 tgcaagtgaa agaggtcaac cggatgcaca tcagtcccaa caatcgaaac gccatccacc 601 ctggggaccg catcctggag atcaatggga cccccgtccg cacacttcga gtggaggagg 661 tggaggatgc aattagccag acgagccaga cacttcagct gttgattgaa catgaccccg 721 tctcccaacg cctggaccag ctgcggctgg aggcccggct cgctcctcac atgcagaatg 781 ccggacaccc ccacgccctc agcaccctgg acaccaagga gaatctggag gggacactga 841 ggagacgttc cctaaggcgc agtaacagta tctccaagtc ccctggcccc agctccccaa 901 aggagcccct gctgttcagc cgtgacatca gccgctcaga atcccttcgt tgttccagca 961 gctattcaca gcagatcttc cggccctgtg acctaatcca tggggaggtc ctggggaagg 1021 gcttctttgg gcaggctatc aaggtgacac acaaagccac gggcaaagtg atggtcatga 1081 aagagttaat tcgatgtgat gaggagaccc agaaaacttt tctgactgag gtgaaagtga 1141 tgcgcagcct ggaccacccc aatgtgctca agttcattgg tgtgctgtac aaggataaga 1201 agctgaacct cctgacagag tacattgagg ggggcacact gaaggacttt ctgcgcagta 1261 tggatccgtt cccctggcag cagaaggtca ggtttgccaa aggaatcgcc tccggaatgg 1321 cctatttgca ctctatgtgc atcatccacc gggatctgaa ctcgcacaac tgcctcatca 1381 agttggacaa gactgtggtg gtggcagact ttgggctgtc acggctcata gtggaagaga 1441 ggaaaagggc ccccatggag aaggccacca ccaagaaacg caccttgcgc aagaacgacc 1501 gcaagaagcg ctacacggtg gtgggaaacc cctactggat ggcccctgag atgctgaacg 1561 gaaagagcta tgatgagacg gtggatatct tctcctttgg gatcgttctc tgtgagatca 1621 ttgggcaggt gtatgcagat cctgactgcc ttccccgaac actggacttt ggcctcaacg 1681 tgaagctttt ctgggagaag tttgttccca cagattgtcc cccggccttc ttcccgctgg 1741 ccgccatctg ctgcagactg gagccTGAGA GCAGAGCCCC CCCCGGGGCC GCAGGAGAGG 1801 GCCCGGGCTG CGCGGATGAT GAGGGCCCAG TGAGGCGCCA AGGGAAGGTC ACCATCAAGT 1861 ATGACCCCAA GGAGCTACGG AAGCACCTCA ACCTAGAGGA GTGGATCCTG GAGCAGCTCA 1921 CGCGCCTCTA CGACTGCCAG GAAGAGGAGA TCTCAGAACT AGAGATTGAC GTGGATGAGC 1981 TCCTGGACAT GGAGAGTGAC GATGCCTGGG CTTCCAGGGT CAAGGAGCTG CTGGTTGACT 2041 GTTACAAACC CACAGAGGCC TTCATCTCTG GCCTGCTGGA CAAGATCCGG GCCATGCAGA 2101 AGCTGAGCAC ACCCCAGAAG AAGAGCCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 2161 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 2221 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAA CTATAGCACA 2281 CTGAAGGTTT GAAACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 2341 att