Transcript: Human NM_138689.3

Homo sapiens protein phosphatase 1 regulatory inhibitor subunit 14B (PPP1R14B), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
PPP1R14B (26472)
Length:
989
CDS:
271..714

Additional Resources:

NCBI RefSeq record:
NM_138689.3
NBCI Gene record:
PPP1R14B (26472)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138689.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052682 CGTCAAGTATGACCGCAAGGA pLKO.1 441 CDS 100% 2.640 1.848 N PPP1R14B n/a
2 TRCN0000249716 AGGGAAGGTCACCGTCAAGTA pLKO_005 429 CDS 100% 4.950 2.970 N Ppp1r14b n/a
3 TRCN0000052678 CTGCTGGTTGACTGTTACAAA pLKO.1 616 CDS 100% 5.625 2.813 Y PPP1R14B n/a
4 TRCN0000052680 CCTCAACCTAGAGGAGTGGAT pLKO.1 474 CDS 100% 2.640 1.320 Y PPP1R14B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138689.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00944 pDONR223 100% 18.9% 15.5% None (many diffs) n/a
2 ccsbBroad304_00944 pLX_304 0% 18.9% 15.5% V5 (many diffs) n/a
3 TRCN0000476079 ACTATAGCACACTGAAGGTTTGAA pLX_317 17.7% 18.9% 15.5% V5 (many diffs) n/a
4 ccsbBroadEn_14690 pDONR223 0% 18.9% 15.5% None (many diffs) n/a
5 ccsbBroad304_14690 pLX_304 0% 18.9% 15.5% V5 (many diffs) n/a
6 TRCN0000474945 GGTTACTTGACCCCGTAACTGTGC pLX_317 18.5% 18.9% 15.5% V5 (many diffs) n/a
7 TRCN0000489081 TAACAAAACCACTATGATTTGCAT pLX_317 16.9% 18.9% 15.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV