Transcript: Human NM_005569.4

Homo sapiens LIM domain kinase 2 (LIMK2), transcript variant 2a, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
LIMK2 (3985)
Length:
3667
CDS:
112..2028

Additional Resources:

NCBI RefSeq record:
NM_005569.4
NBCI Gene record:
LIMK2 (3985)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148526 CCTCCTCCACTCGAAGTGTG pXPR_003 CGG 641 33% 6 0.1956 LIMK2 LIMK2 75972
2 BRDN0001148972 CTGACAGAGTACATTGAGGG pXPR_003 GGG 1226 64% 10 -0.0094 LIMK2 LIMK2 75974
3 BRDN0001147235 ACTGTCAACGAAACCTGGCA pXPR_003 CGG 98 5% 2 -0.0241 LIMK2 LIMK2 75973
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005569.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234388 TCGTTCTCTGTGAGATCATTG pLKO_005 1712 CDS 100% 10.800 15.120 N LIMK2 n/a
2 TRCN0000218291 CTATGAGCTTGCACCATATTT pLKO_005 3271 3UTR 100% 15.000 10.500 N LIMK2 n/a
3 TRCN0000234389 CAGACCAGCATTCTCGAAATT pLKO_005 1881 CDS 100% 13.200 9.240 N LIMK2 n/a
4 TRCN0000195118 CAGAGTTTACTTGCTATATAG pLKO.1 3463 3UTR 100% 13.200 9.240 N LIMK2 n/a
5 TRCN0000234386 ATGGCCTATTTGCACTCTATG pLKO_005 1426 CDS 100% 10.800 7.560 N LIMK2 n/a
6 TRCN0000361250 CCCTCACCAACTGGTACTATG pLKO_005 248 CDS 100% 10.800 7.560 N Limk2 n/a
7 TRCN0000022472 GATGCACATCAGTCCCAACAA pLKO.1 672 CDS 100% 4.950 3.465 N Limk2 n/a
8 TRCN0000199881 GCCTCCGGAATGGCCTATTTG pLKO.1 1417 CDS 100% 4.400 3.080 N LIMK2 n/a
9 TRCN0000010237 CAGAAGGTCAGGTTTGCCAAA pLKO.1 1390 CDS 100% 4.050 2.835 N LIMK2 n/a
10 TRCN0000010240 CCCTGAGATGCTGAACGGAAA pLKO.1 1653 CDS 100% 4.050 2.835 N LIMK2 n/a
11 TRCN0000010241 CTGTATGAGCTGCAAGGTGAT pLKO.1 402 CDS 100% 4.050 2.835 N LIMK2 n/a
12 TRCN0000010242 CCAGACGAGCCAGACACTTCA pLKO.1 786 CDS 100% 1.650 1.155 N LIMK2 n/a
13 TRCN0000234387 CTATGATGAGACGGTGGATAT pLKO_005 1677 CDS 100% 10.800 6.480 N LIMK2 n/a
14 TRCN0000022471 GTGAGATCATTGGGCAGGTAT pLKO.1 1721 CDS 100% 4.950 3.960 N Limk2 n/a
15 TRCN0000245195 AGGAGGTGGAGGATGCAATAA pLKO_005 764 CDS 100% 13.200 7.920 N Limk2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005569.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489792 GGCTGGCGCCTCCGGCAGGACCCC pLX_317 20% 99.9% 100% V5 1209C>G n/a
2 TRCN0000489285 CCATGCAAAGCCTCTTAGCTCCGG pLX_317 20.4% 99.9% 100% V5 (not translated due to prior stop codon) 1209C>G n/a
3 ccsbBroadEn_00944 pDONR223 100% 83.9% 74.3% None (many diffs) n/a
4 ccsbBroad304_00944 pLX_304 0% 83.9% 74.3% V5 (many diffs) n/a
5 TRCN0000476079 ACTATAGCACACTGAAGGTTTGAA pLX_317 17.7% 83.9% 74.3% V5 (many diffs) n/a
6 ccsbBroadEn_14690 pDONR223 0% 83.9% 74.3% None (many diffs) n/a
7 ccsbBroad304_14690 pLX_304 0% 83.9% 74.3% V5 (many diffs) n/a
8 TRCN0000474945 GGTTACTTGACCCCGTAACTGTGC pLX_317 18.5% 83.9% 74.3% V5 (many diffs) n/a
9 TRCN0000489081 TAACAAAACCACTATGATTTGCAT pLX_317 16.9% 83.9% 74.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV