Transcript: Mouse XM_011243666.2

PREDICTED: Mus musculus LIM motif-containing protein kinase 2 (Limk2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Limk2 (16886)
Length:
3346
CDS:
162..1862

Additional Resources:

NCBI RefSeq record:
XM_011243666.2
NBCI Gene record:
Limk2 (16886)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243666.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361304 ATCAGTCCCAACAACCGAAAT pLKO_005 495 CDS 100% 10.800 15.120 N Limk2 n/a
2 TRCN0000378403 TGAGTTGCAAGGTGATCATTG pLKO_005 223 CDS 100% 10.800 15.120 N Limk2 n/a
3 TRCN0000245196 TCCTCTGGAATGGCCTATTTA pLKO_005 1251 CDS 100% 15.000 10.500 N Limk2 n/a
4 TRCN0000361249 ACACAACTGTCTCATCAAATT pLKO_005 1307 CDS 100% 13.200 9.240 N Limk2 n/a
5 TRCN0000245195 AGGAGGTGGAGGATGCAATAA pLKO_005 580 CDS 100% 13.200 9.240 N Limk2 n/a
6 TRCN0000245198 GAGATCATTGGGCAGGTATAT pLKO_005 1557 CDS 100% 13.200 9.240 N Limk2 n/a
7 TRCN0000245197 TTTGGGCTGTCACGGCTTATA pLKO_005 1353 CDS 100% 13.200 9.240 N Limk2 n/a
8 TRCN0000378529 AGGACTACTGGGCCAAGTTTG pLKO_005 112 5UTR 100% 10.800 7.560 N Limk2 n/a
9 TRCN0000368024 AGGACTTGAAGCGGTAGTATG pLKO_005 2281 3UTR 100% 10.800 7.560 N Limk2 n/a
10 TRCN0000361250 CCCTCACCAACTGGTACTATG pLKO_005 64 5UTR 100% 10.800 7.560 N Limk2 n/a
11 TRCN0000368023 GTGAAATGACAGTAGCGATTT pLKO_005 2332 3UTR 100% 10.800 7.560 N Limk2 n/a
12 TRCN0000234388 TCGTTCTCTGTGAGATCATTG pLKO_005 1546 CDS 100% 10.800 7.560 N LIMK2 n/a
13 TRCN0000022473 CAAAGGCATCTCCTCTGGAAT pLKO.1 1241 CDS 100% 4.950 3.465 N Limk2 n/a
14 TRCN0000022472 GATGCACATCAGTCCCAACAA pLKO.1 488 CDS 100% 4.950 3.465 N Limk2 n/a
15 TRCN0000022469 GCTGCAAACTAGAGCCTGAAA pLKO.1 1693 CDS 100% 4.950 3.465 N Limk2 n/a
16 TRCN0000022471 GTGAGATCATTGGGCAGGTAT pLKO.1 1555 CDS 100% 4.950 3.465 N Limk2 n/a
17 TRCN0000010237 CAGAAGGTCAGGTTTGCCAAA pLKO.1 1224 CDS 100% 4.050 2.835 N LIMK2 n/a
18 TRCN0000367978 GGACTTTGGCCTCAATGTTAA pLKO_005 1607 CDS 100% 13.200 7.920 N Limk2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243666.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489792 GGCTGGCGCCTCCGGCAGGACCCC pLX_317 20% 77.3% 82.7% V5 (many diffs) n/a
2 TRCN0000489285 CCATGCAAAGCCTCTTAGCTCCGG pLX_317 20.4% 77.3% 82.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_00944 pDONR223 100% 70.1% 66.8% None (many diffs) n/a
4 ccsbBroad304_00944 pLX_304 0% 70.1% 66.8% V5 (many diffs) n/a
5 TRCN0000476079 ACTATAGCACACTGAAGGTTTGAA pLX_317 17.7% 70.1% 66.8% V5 (many diffs) n/a
6 ccsbBroadEn_14690 pDONR223 0% 70.1% 66.8% None (many diffs) n/a
7 ccsbBroad304_14690 pLX_304 0% 70.1% 66.8% V5 (many diffs) n/a
8 TRCN0000474945 GGTTACTTGACCCCGTAACTGTGC pLX_317 18.5% 70.1% 66.8% V5 (many diffs) n/a
9 TRCN0000489081 TAACAAAACCACTATGATTTGCAT pLX_317 16.9% 70.1% 66.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV