Construct: ORF TRCN0000476121
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016934.1_s317c1
- Derived from:
- ccsbBroadEn_15704
- DNA Barcode:
- TGACGCCCTATAAAGAGCGGCAAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TFG (10342)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476121
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 10342 | TFG | trafficking from ER to golg... | NM_001195479.1 | 92.4% | 54.1% | 729delC;1100_1188del |
2 | human | 10342 | TFG | trafficking from ER to golg... | XM_005247066.2 | 92.4% | 54.1% | 729delC;1100_1188del |
3 | human | 10342 | TFG | trafficking from ER to golg... | XM_017005527.1 | 92.4% | 54.1% | 729delC;1100_1188del |
4 | human | 10342 | TFG | trafficking from ER to golg... | NM_001007565.2 | 91.5% | 53.6% | 708_719del;741delC;1112_1200del |
5 | human | 10342 | TFG | trafficking from ER to golg... | NM_001195478.1 | 91.5% | 53.6% | 708_719del;741delC;1112_1200del |
6 | human | 10342 | TFG | trafficking from ER to golg... | NM_006070.6 | 91.5% | 53.6% | 708_719del;741delC;1112_1200del |
7 | human | 10342 | TFG | trafficking from ER to golg... | XM_006713472.1 | 91.5% | 53.6% | 708_719del;741delC;1112_1200del |
8 | human | 10342 | TFG | trafficking from ER to golg... | XM_011512334.1 | 91.5% | 53.6% | 708_719del;741delC;1112_1200del |
9 | mouse | 21787 | Tfg | Trk-fused gene | XM_006521981.3 | 82.9% | 52.4% | (many diffs) |
10 | mouse | 21787 | Tfg | Trk-fused gene | NM_019678.3 | 82.1% | 51.9% | (many diffs) |
11 | mouse | 21787 | Tfg | Trk-fused gene | XM_006521980.2 | 82.1% | 51.9% | (many diffs) |
12 | mouse | 21787 | Tfg | Trk-fused gene | NM_001252443.1 | 70.3% | 42.1% | (many diffs) |
13 | mouse | 21787 | Tfg | Trk-fused gene | XM_006521983.3 | 68.4% | 62% | (many diffs) |
14 | mouse | 21787 | Tfg | Trk-fused gene | XM_006521982.3 | 67.6% | 61.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1167
- ORF length:
- 1098
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaacggacag ttggatctaa gtgggaagct aatcatcaaa gctcaacttg 121 gggaggatat tcggcgaatt cctattcata atgaagatat tacttatgat gaattagtgc 181 taatgatgca acgagttttc agaggaaaac ttctgagtaa tgatgaagta acaataaagt 241 ataaagatga agatggagat cttataacaa tttttgatag ttctgacctt tcctttgcaa 301 ttcagtgcag taggatactg aaactgacat tatttgttaa tggccagcca agaccccttg 361 aatcaagtca ggtgaaatat ctccgtcgag aactgataga acttcgaaat aaagtgaatc 421 gtttattgga tagcttggaa ccacctggag aaccaggacc ttccaccaat attcctgaaa 481 atgatactgt ggatggtagg gaagaaaagt ctgcttctga ttcttctgga aaacagtcta 541 ctcaggttat ggcagcaagt atgtctgctt ttgatccttt aaaaaaccaa gatgaaatca 601 ataaaaatgt tatgtcagcg tttggcttaa cagatgatca ggtttcaggg ccacccagtg 661 ctcctgcaga agatcgttca ggaacacccg acagcattgc ttcctcctcc tcagcagctc 721 acccaccagg cgttcagcca cagcagccac catatacagg agcTCAGACT CAAGCAGGTC 781 AGATGTACCA ACAGTACAGC AACAGGCCGG CTATGGTGCA CAGCAGCCGC AGGCTCCACC 841 TCAGCAGCCT CAACAGTATG GTATTCAGTA TTCAGCAAGC TATAGTCAGC AGACTGGACC 901 TCAACAACCT CAGCAGTTCC AGGGATATGG CCAGCAACCA ACTTCCCAGG CACCAGCTCC 961 TGCCTTTTCT GGTCAGCCTC AACAACTGCC TGCTCAGCCG CCACAGCAGT ACCAGGCGAG 1021 CAATTATCCT GCACAAACTT ACACTGCCCA AACTTCTCAG CCTACTAATT ATACTGTGGC 1081 TCCTGCCTCT CAACCTGGAA TGGCTCCAAG CCAACCTGGG GCCTATCAAC CAAGACCAGG 1141 TTTTACTTCA CTTCCTGGAA GTACCATTGC CAACTTTCTT GTACAAAGTG GTTGATATCG 1201 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1261 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATGACGCCC 1321 TATAAAGAGC GGCAATACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1381 aagatt