Construct: ORF TRCN0000476174
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012333.1_s317c1
- Derived from:
- ccsbBroadEn_08034
- DNA Barcode:
- CTCAACAGGGGAATCCGTTACGGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- OR7A5 (26659)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476174
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 26659 | OR7A5 | olfactory receptor family 7... | NM_001370480.1 | 99.8% | 100% | 438A>G |
| 2 | human | 26659 | OR7A5 | olfactory receptor family 7... | NM_001370481.1 | 99.8% | 100% | 438A>G |
| 3 | human | 26659 | OR7A5 | olfactory receptor family 7... | NM_001370482.1 | 99.8% | 100% | 438A>G |
| 4 | human | 26659 | OR7A5 | olfactory receptor family 7... | NM_001370483.1 | 99.8% | 100% | 438A>G |
| 5 | human | 26659 | OR7A5 | olfactory receptor family 7... | NM_017506.2 | 99.8% | 100% | 438A>G |
| 6 | human | 390892 | OR7A10 | olfactory receptor family 7... | NM_001005190.1 | 84.6% | 78% | (many diffs) |
| 7 | human | 26333 | OR7A17 | olfactory receptor family 7... | NM_030901.1 | 84.1% | 77.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1026
- ORF length:
- 957
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggaaccagga aatgatacac aaatttcaga atttcttctt ctgggatttt 121 cacaagaacc tggactgcaa cccttcctct ttgggctgtt cctgtccatg tacctggtca 181 ctgtgctcgg gaacctgctc atcatcctgg ccacaatctc agactcccac ctccacaccc 241 ccatgtactt cttcctctcc aacctgtcct ttgctgacat ttgtgttact tccaccacca 301 ttccaaaaat gctgatgaac atccagacac agaacaaagt catcacctac atagcctgcc 361 tcatgcagat gtattttttc atactctttg ctggatttga aaacttcctc ctgtccgtga 421 tggcctatga ccggtttgtg gccatctgtc accccctgca ctacatggtc attatgaacc 481 ctcacctctg tggactgctg gttctggcat cctggaccat gagtgctctg tattccttgc 541 tacaaatctt aatggtagta cggctgtcct tctgcacagc cttagaaatc ccccactttt 601 tctgtgaact taatcaggtc atccaacttg cttgttctga tagctttctt aatcacatgg 661 tgatatattt tacagttgcg ctgctgggtg gaggtcccct gactgggaTC CTTTACTCTT 721 ACTCTAAGAT AATTTCTTCC ATACATGCAA TCTCATCAGC TCAGGGGAAG TACAAGGCAT 781 TTTCCACCTG TGCATCTCAC CTCTCAGTTG TCTCCTTATT TTATGGTGCA ATCCTAGGGG 841 TGTACCTTAG TTCTGCTGCC ACCCGCAACT CACACTCAAG TGCAACAGCC TCAGTGATGT 901 ACACTGTGGT CACCCCCATG CTGAACCCCT TTATCTATAG TCTGAGGAAT AAAGACATAA 961 AGAGGGCTCT GGGAATACAT TTGTTGTGGG GAACAATGAA AGGGCAATTT TTCAAGAAGT 1021 GCCCATTGCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1081 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGGA ACTTGAAAGT ATTTCGATTT 1141 CTTGGCTTTA TATATCTTGT GGAAAGGACG ACTCAACAGG GGAATCCGTT ACGGAACGCG 1201 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt