Construct: ORF TRCN0000476229
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002423.1_s317c1
- Derived from:
- ccsbBroadEn_13590
- DNA Barcode:
- GCACGGCGTATATCCGTGCTGATT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ARMH1 (339541)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476229
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 339541 | ARMH1 | armadillo like helical doma... | XM_017001144.1 | 88.1% | 82% | 846_847insGACCCCTCGGTTCTCCA;905_1008del |
2 | human | 339541 | ARMH1 | armadillo like helical doma... | XM_017001145.1 | 84.6% | 78.7% | (many diffs) |
3 | human | 339541 | ARMH1 | armadillo like helical doma... | XM_017001146.2 | 83.5% | 80.1% | (many diffs) |
4 | human | 339541 | ARMH1 | armadillo like helical doma... | XM_017001143.1 | 81.2% | 75.7% | 846_847insGACCCCTCGGTTCTCCA;904_1095delinsG |
5 | human | 339541 | ARMH1 | armadillo like helical doma... | XM_017001147.1 | 78.8% | 78.5% | 724_725insCC;726_727ins193 |
6 | human | 339541 | ARMH1 | armadillo like helical doma... | XM_017001142.1 | 75.8% | 70.8% | 846_847insGACCCCTCGGTTCTCCA;904_1173delinsG |
7 | human | 339541 | ARMH1 | armadillo like helical doma... | XM_017001140.1 | 71.1% | 71.2% | 921_1293delinsG |
8 | human | 339541 | ARMH1 | armadillo like helical doma... | NM_001145636.2 | 69.7% | 69.7% | 922_1320del |
9 | human | 339541 | ARMH1 | armadillo like helical doma... | XM_006710603.2 | 68.7% | 68.8% | 921_1338delinsG |
10 | human | 339541 | ARMH1 | armadillo like helical doma... | XM_006710604.2 | 68.7% | 68.8% | 921_1338delinsG |
11 | human | 339541 | ARMH1 | armadillo like helical doma... | XM_011541340.1 | 68.7% | 68.8% | 921_1338delinsG |
12 | human | 339541 | ARMH1 | armadillo like helical doma... | XM_011541341.1 | 68.7% | 68.8% | 921_1338delinsG |
13 | human | 339541 | ARMH1 | armadillo like helical doma... | XM_011541343.1 | 68.7% | 68.8% | 921_1338delinsG |
14 | human | 339541 | ARMH1 | armadillo like helical doma... | XM_011541345.1 | 65.6% | 65.6% | 1_1delAins40;3G>A;882_1299delinsG |
15 | human | 339541 | ARMH1 | armadillo like helical doma... | XR_001737147.1 | 54.9% | 1_578del;1499_1673delinsG | |
16 | human | 339541 | ARMH1 | armadillo like helical doma... | XR_001737144.1 | 53.9% | 1_190del;1036_1037insGACCCCTCGGTTCTCCA;1094_1657delinsG | |
17 | human | 339541 | ARMH1 | armadillo like helical doma... | XR_001737143.1 | 53.1% | 1_191del;1037_1038insGACCCCTCGGTTCTCCA;1096_1685del | |
18 | human | 339541 | ARMH1 | armadillo like helical doma... | XM_011541349.2 | 53% | 53.1% | 0_1ins210;711_1128delinsG |
19 | human | 339541 | ARMH1 | armadillo like helical doma... | XR_001737142.1 | 52.4% | 1_192del;1038_1039insGACCCCTCGGTTCTCCA;1096_1704delinsG | |
20 | human | 339541 | ARMH1 | armadillo like helical doma... | XR_001737141.1 | 50.1% | 1_190del;1036_1037insGACCCCTCGGTTCTCCA;1095_1787del | |
21 | human | 339541 | ARMH1 | armadillo like helical doma... | XR_001737140.1 | 49.5% | 1_190del;1036_1037insGACCCCTCGGTTCTCCA;1094_1805delinsG | |
22 | human | 339541 | ARMH1 | armadillo like helical doma... | XR_001737146.1 | 46.9% | 1_578del;1499_1959delinsG | |
23 | human | 339541 | ARMH1 | armadillo like helical doma... | XR_001737139.1 | 41.6% | 1_578del;1499_2210delinsG |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 987
- ORF length:
- 921
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac ttctataaag gagcaggcag caattagcag gctcttaagt tttttacagg 121 agtgggacaa cgctggcaaa gtcgcaagga gtcacatcct cgacaagttc attgaaacca 181 accaaggcaa gactgcccct gaactggagc aggagttttc ccagggagcc agtttgttcc 241 tggtacgctt gaccacctcg cttagaatca cctatatgac tgactcatgt ttagaaaagc 301 ttctcaggtc cattggcatc ttcttatcag ctgtaagcag taatcggtac cttatagaat 361 ttcttgaggt tggaggtgtc ctaaccctct tggaaatact tgggctagag aagatcaagg 421 aggaggccaa gaaggaatct gtcaaactac ttcaggttat tgcgaactct ggcaggacat 481 acaaggaact catttgtgaa agctatggtg tacgatccat agcagaattt ttggcaaagt 541 ctaagtcaga agagacccag gaggaagtgc aggttctgtt ggattctttg gtccacggca 601 atcccaagta ccaaaatcaa gtgtataaag gtctaatagc tttgctgccc tgcgagtccc 661 caaaagccca gcagctgtcc ctgcagactc TCAGGACTGC CCAGCCAATC ATTGGGACCA 721 CACACCCCAG CATCGTGGAC TGCGTGCTGA AGGTGCTGGG CACGATGCAC CTGGAAGTCC 781 AGTATGAAGC CATCGAGTTG ATCAAAGACC TGGTCGGTTA CGATGTGCGC CAGGCGCTGC 841 TCAAGGGCCT CGTGGCGCTG CTGATACCGT CGGTCAAGGA GATCTCCAAA CTGCAGGCCA 901 AGATCCTCAG TGACCCCTCG GTTCTCCAGC TCACCCCCAG CCTGCCGATG TTTTTGCAGC 961 AGGCCGCGGC CGCCAAGGCC ATCGGGTACC CAACTTTCTT GTACAAAGTG GTTGATATCG 1021 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1081 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAGCACGGCG 1141 TATATCCGTG CTGATTACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1201 aagatt