Transcript: Human XM_006710603.2

PREDICTED: Homo sapiens armadillo like helical domain containing 1 (ARMH1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARMH1 (339541)
Length:
1983
CDS:
455..1795

Additional Resources:

NCBI RefSeq record:
XM_006710603.2
NBCI Gene record:
ARMH1 (339541)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006710603.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336686 CAAGTGTATAAAGGTCTAATA pLKO_005 1007 CDS 100% 13.200 18.480 N ARMH1 n/a
2 TRCN0000336685 TCGCTTAGAATCACCTATATG pLKO_005 647 CDS 100% 13.200 10.560 N ARMH1 n/a
3 TRCN0000336687 GGACATACAAGGAACTCATTT pLKO_005 864 CDS 100% 13.200 9.240 N ARMH1 n/a
4 TRCN0000336763 TTATCAGCTGTAAGCAGTAAT pLKO_005 713 CDS 100% 13.200 9.240 N ARMH1 n/a
5 TRCN0000336759 CCTCGACAAGTTCATTGAAAC pLKO_005 547 CDS 100% 10.800 7.560 N ARMH1 n/a
6 TRCN0000168648 GCTGAGGACTTGTACATGAAA pLKO.1 1607 CDS 100% 5.625 3.938 N ARMH1 n/a
7 TRCN0000168812 CAGGACATACAAGGAACTCAT pLKO.1 862 CDS 100% 4.950 3.465 N ARMH1 n/a
8 TRCN0000172632 GAGTCACATCCTCGACAAGTT pLKO.1 538 CDS 100% 4.950 3.465 N ARMH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006710603.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13590 pDONR223 100% 68.7% 68.8% None 921_1338delinsG n/a
2 ccsbBroad304_13590 pLX_304 0% 68.7% 68.8% V5 921_1338delinsG n/a
3 TRCN0000476229 GCACGGCGTATATCCGTGCTGATT pLX_317 32.6% 68.7% 68.8% V5 921_1338delinsG n/a
Download CSV