Transcript: Human XM_017001145.1

PREDICTED: Homo sapiens armadillo like helical domain containing 1 (ARMH1), transcript variant X20, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARMH1 (339541)
Length:
1688
CDS:
201..1025

Additional Resources:

NCBI RefSeq record:
XM_017001145.1
NBCI Gene record:
ARMH1 (339541)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001145.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336686 CAAGTGTATAAAGGTCTAATA pLKO_005 753 CDS 100% 13.200 18.480 N ARMH1 n/a
2 TRCN0000336685 TCGCTTAGAATCACCTATATG pLKO_005 393 CDS 100% 13.200 10.560 N ARMH1 n/a
3 TRCN0000336687 GGACATACAAGGAACTCATTT pLKO_005 610 CDS 100% 13.200 9.240 N ARMH1 n/a
4 TRCN0000336763 TTATCAGCTGTAAGCAGTAAT pLKO_005 459 CDS 100% 13.200 9.240 N ARMH1 n/a
5 TRCN0000336759 CCTCGACAAGTTCATTGAAAC pLKO_005 293 CDS 100% 10.800 7.560 N ARMH1 n/a
6 TRCN0000168812 CAGGACATACAAGGAACTCAT pLKO.1 608 CDS 100% 4.950 3.465 N ARMH1 n/a
7 TRCN0000172632 GAGTCACATCCTCGACAAGTT pLKO.1 284 CDS 100% 4.950 3.465 N ARMH1 n/a
8 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 1653 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001145.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13590 pDONR223 100% 84.6% 78.7% None (many diffs) n/a
2 ccsbBroad304_13590 pLX_304 0% 84.6% 78.7% V5 (many diffs) n/a
3 TRCN0000476229 GCACGGCGTATATCCGTGCTGATT pLX_317 32.6% 84.6% 78.7% V5 (many diffs) n/a
Download CSV