Construct: ORF TRCN0000476259
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007477.1_s317c1
- Derived from:
- ccsbBroadEn_01938
- DNA Barcode:
- TGCTGTAGAAACTTGGTTCCACCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GEMIN2 (8487)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476259
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 8487 | GEMIN2 | gem nuclear organelle assoc... | NM_003616.2 | 100% | 100% | |
2 | human | 8487 | GEMIN2 | gem nuclear organelle assoc... | NM_001009182.1 | 94.6% | 94.6% | 519_520ins45 |
3 | human | 8487 | GEMIN2 | gem nuclear organelle assoc... | NM_001009183.1 | 89.2% | 88.5% | 745_746insA;747_748ins25;750_751ins64 |
4 | human | 8487 | GEMIN2 | gem nuclear organelle assoc... | XM_017021709.1 | 83.9% | 83.2% | (many diffs) |
5 | human | 8487 | GEMIN2 | gem nuclear organelle assoc... | XM_024449731.1 | 52.1% | 52.1% | 0_1ins402 |
6 | mouse | 66603 | Gemin2 | gem nuclear organelle assoc... | NM_025656.5 | 85.8% | 90.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 909
- ORF length:
- 840
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gcgccgagcg gaactggctg gtttgaaaac catggcgtgg gtaccagcgg 121 agtccgcagt ggaagagttg atgcctcggc tattgccggt agagccttgc gacttgacgg 181 aaggtttcga tccctcggta cccccgagga cgcctcagga atacctgagg cgggtccaga 241 tcgaagcagc tcaatgtcca gatgttgtgg tagctcaaat tgacccaaag aagttgaaaa 301 ggaagcaaag tgtgaatatt tctctttcag gatgccaacc cgcccctgaa ggttattccc 361 caacacttca atggcaacag caacaagtgg cacagttttc aactgttcga cagaatgtga 421 acaaacatag aagtcactgg aaatcacaac agttggatag taatgtgaca atgccaaaat 481 ctgaagatga agaaggctgg aagaaatttt gtctgggtga aaagttatgt gctgacgggg 541 ctgttggacc agccacaaat gaaagtcctg gaatagatta tgtacaaatt ggtttTCCTC 601 CCTTGCTTAG TATTGTTAGC AGAATGAATC AGGCAACAGT AACTAGTGTC TTGGAATATC 661 TGAGTAATTG GTTTGGAGAA AGAGACTTTA CTCCAGAATT GGGAAGATGG CTTTATGCTT 721 TATTGGCTTG TCTTGAAAAG CCTTTGTTAC CTGAGGCTCA TTCACTGATT CGGCAGCTTG 781 CAAGAAGGTG CTCTGAAGTG AGGCTCTTAG TGGATAGCAA AGATGATGAG AGGGTTCCTG 841 CTTTGAATTT ATTAATCTGC TTGGTTAGCA GGTATTTTGA CCAACGTGAT TTAGCTGATG 901 AGCCATCTTT GCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 961 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1021 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGATGCTGT AGAAACTTGG TTCCACCGAC 1081 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt