Transcript: Human XM_024449731.1

PREDICTED: Homo sapiens gem nuclear organelle associated protein 2 (GEMIN2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GEMIN2 (8487)
Length:
1240
CDS:
355..795

Additional Resources:

NCBI RefSeq record:
XM_024449731.1
NBCI Gene record:
GEMIN2 (8487)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449731.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033435 GCTTAGTATTGTTAGCAGAAT pLKO.1 489 CDS 100% 4.950 6.930 N GEMIN2 n/a
2 TRCN0000033437 CTGCTTGGTTAGCAGGTATTT pLKO.1 741 CDS 100% 1.320 1.056 N GEMIN2 n/a
3 TRCN0000299584 CTGCTTGGTTAGCAGGTATTT pLKO_005 741 CDS 100% 1.320 1.056 N GEMIN2 n/a
4 TRCN0000033438 CCTCCCTTGCTTAGTATTGTT pLKO.1 481 CDS 100% 5.625 3.938 N GEMIN2 n/a
5 TRCN0000299583 CCTCCCTTGCTTAGTATTGTT pLKO_005 481 CDS 100% 5.625 3.938 N GEMIN2 n/a
6 TRCN0000033434 CGACAGAATGTGAACAAACAT pLKO.1 292 5UTR 100% 5.625 3.938 N GEMIN2 n/a
7 TRCN0000299528 CGACAGAATGTGAACAAACAT pLKO_005 292 5UTR 100% 5.625 3.938 N GEMIN2 n/a
8 TRCN0000033436 CCAGATGTTGTGGTAGCTCAA pLKO.1 142 5UTR 100% 4.050 2.835 N GEMIN2 n/a
9 TRCN0000310428 CCAGATGTTGTGGTAGCTCAA pLKO_005 142 5UTR 100% 4.050 2.835 N GEMIN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449731.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01938 pDONR223 100% 52.1% 52.1% None 0_1ins402 n/a
2 ccsbBroad304_01938 pLX_304 37.3% 52.1% 52.1% V5 0_1ins402 n/a
3 TRCN0000476259 TGCTGTAGAAACTTGGTTCCACCG pLX_317 37.5% 52.1% 52.1% V5 0_1ins402 n/a
Download CSV