Construct: ORF TRCN0000476393
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000396.1_s317c1
- Derived from:
- ccsbBroadEn_04944
- DNA Barcode:
- TAATTAACCGTTTGAACTGCAACT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SAMD10 (140700)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476393
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 140700 | SAMD10 | sterile alpha motif domain ... | NM_080621.5 | 100% | 100% | |
| 2 | human | 140700 | SAMD10 | sterile alpha motif domain ... | XM_017027671.1 | 100% | 100% | |
| 3 | human | 140700 | SAMD10 | sterile alpha motif domain ... | XM_006723705.3 | 86.1% | 77.7% | (many diffs) |
| 4 | human | 140700 | SAMD10 | sterile alpha motif domain ... | XM_005260199.4 | 83.8% | 83.8% | 91_207del |
| 5 | human | 140700 | SAMD10 | sterile alpha motif domain ... | XM_011528565.2 | 47.4% | 41.3% | (many diffs) |
| 6 | mouse | 229011 | Samd10 | sterile alpha motif domain ... | NM_172676.2 | 89.2% | 92% | (many diffs) |
| 7 | mouse | 229011 | Samd10 | sterile alpha motif domain ... | XM_006500607.3 | 74% | 77.2% | (many diffs) |
| 8 | mouse | 229011 | Samd10 | sterile alpha motif domain ... | XM_011239939.2 | 53.6% | 55% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 675
- ORF length:
- 606
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gttcaccgag ctgaggtcca agctgagccc cccgcgtggc cgcgccgggg 121 ccgtgcgcgc gggcttcggg gagcgccggg atgtggacgc cactgcccac ttcagcttct 181 gccggaccct cctggagcac acggtgtcag ctgagagcat cccctgccac ttgcctcgga 241 cacctggcac cagcctcacg tggcatgact cccgcagcca gagggcggcc agcagcaggc 301 caatcaagct cctgcagcag cccggcacag acacccccca gggccggctg tactctgacc 361 actatggcct gtaccataca agcccctcgc tgggtggcct gacccggccc gtggtcctgt 421 ggagtcagca ggacgtctgc aagtggctca agaagcactg tccccacaac tacctcGTCT 481 ACGTGGAGGC CTTCTCCCAG CATGCCATCA CCGGCCGGGC ACTGCTGCGG CTGAATGCGG 541 AGAAGCTGCA GCGGATGGGG CTGGCCCAGG AGGCCCAGAG GCAGGAGGTG CTGCAGCAGG 601 TGCTCCGCCT GCAGGTGCGT GAGGAGGGGC GGAGCCTGCA GCTGCTCAGC CAAGCTTCCT 661 TCGGGAAAAT GTCCTTGCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 721 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 781 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA TAATTAACCG TTTGAACTGC 841 AACTACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt