Transcript: Human XM_017027671.1

PREDICTED: Homo sapiens sterile alpha motif domain containing 10 (SAMD10), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SAMD10 (140700)
Length:
3198
CDS:
1193..1801

Additional Resources:

NCBI RefSeq record:
XM_017027671.1
NBCI Gene record:
SAMD10 (140700)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027671.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166912 CCAAGCACTTTCATCATTATT pLKO.1 2379 3UTR 100% 15.000 10.500 N SAMD10 n/a
2 TRCN0000257216 CCAAGCACTTTCATCATTATT pLKO_005 2379 3UTR 100% 15.000 10.500 N SAMD10 n/a
3 TRCN0000243978 GGCTGTACTCTGACCACTATG pLKO_005 1470 CDS 100% 10.800 7.560 N SAMD10 n/a
4 TRCN0000257186 CGTCTGCAAGTGGCTCAAGAA pLKO_005 1558 CDS 100% 4.950 3.465 N SAMD10 n/a
5 TRCN0000172950 GCCAACCCATCATCTAGAGTA pLKO.1 2325 3UTR 100% 4.950 3.465 N SAMD10 n/a
6 TRCN0000243979 AGCCAAGCTTCCTTCGGGAAA pLKO_005 1772 CDS 100% 4.050 2.835 N SAMD10 n/a
7 TRCN0000243977 CCACAACTACCTCGTCTACGT pLKO_005 1588 CDS 100% 2.640 1.584 N SAMD10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027671.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04944 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04944 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476393 TAATTAACCGTTTGAACTGCAACT pLX_317 33.2% 100% 100% V5 n/a
Download CSV