Transcript: Human XM_006723705.3

PREDICTED: Homo sapiens sterile alpha motif domain containing 10 (SAMD10), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SAMD10 (140700)
Length:
2080
CDS:
57..683

Additional Resources:

NCBI RefSeq record:
XM_006723705.3
NBCI Gene record:
SAMD10 (140700)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006723705.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166912 CCAAGCACTTTCATCATTATT pLKO.1 1261 3UTR 100% 15.000 10.500 N SAMD10 n/a
2 TRCN0000257216 CCAAGCACTTTCATCATTATT pLKO_005 1261 3UTR 100% 15.000 10.500 N SAMD10 n/a
3 TRCN0000243978 GGCTGTACTCTGACCACTATG pLKO_005 352 CDS 100% 10.800 7.560 N SAMD10 n/a
4 TRCN0000257186 CGTCTGCAAGTGGCTCAAGAA pLKO_005 440 CDS 100% 4.950 3.465 N SAMD10 n/a
5 TRCN0000172950 GCCAACCCATCATCTAGAGTA pLKO.1 1207 3UTR 100% 4.950 3.465 N SAMD10 n/a
6 TRCN0000243979 AGCCAAGCTTCCTTCGGGAAA pLKO_005 654 CDS 100% 4.050 2.835 N SAMD10 n/a
7 TRCN0000243977 CCACAACTACCTCGTCTACGT pLKO_005 470 CDS 100% 2.640 1.584 N SAMD10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006723705.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04944 pDONR223 100% 86.1% 77.7% None (many diffs) n/a
2 ccsbBroad304_04944 pLX_304 0% 86.1% 77.7% V5 (many diffs) n/a
3 TRCN0000476393 TAATTAACCGTTTGAACTGCAACT pLX_317 33.2% 86.1% 77.7% V5 (many diffs) n/a
Download CSV