Transcript: Mouse XM_006500607.3

PREDICTED: Mus musculus sterile alpha motif domain containing 10 (Samd10), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Samd10 (229011)
Length:
1960
CDS:
68..592

Additional Resources:

NCBI RefSeq record:
XM_006500607.3
NBCI Gene record:
Samd10 (229011)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500607.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216902 GCTTCGACTGAATGCAGATAA pLKO.1 439 CDS 100% 13.200 18.480 N Samd10 n/a
2 TRCN0000248705 GCTTCGACTGAATGCAGATAA pLKO_005 439 CDS 100% 13.200 18.480 N Samd10 n/a
3 TRCN0000184515 GCCAACAAGACGTTTGCAAGT pLKO.1 339 CDS 100% 4.050 5.670 N Samd10 n/a
4 TRCN0000248708 TGATTATGAAACGTCAGTATA pLKO_005 1165 3UTR 100% 13.200 9.240 N Samd10 n/a
5 TRCN0000248707 CAGTATCAGCTGAGAACATAC pLKO_005 117 CDS 100% 10.800 7.560 N Samd10 n/a
6 TRCN0000248706 TGTCCTAGCTGCTGCCTATAC pLKO_005 585 CDS 100% 10.800 7.560 N Samd10 n/a
7 TRCN0000248709 GTGGAGCCAACAAGACGTTTG pLKO_005 334 CDS 100% 6.000 4.200 N Samd10 n/a
8 TRCN0000178940 CAAGAAGCATTGTCCTCACAA pLKO.1 364 CDS 100% 4.950 3.465 N Samd10 n/a
9 TRCN0000196050 GCCTGCTTATAGACCCTTCTT pLKO.1 806 3UTR 100% 4.950 3.465 N Samd10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500607.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04944 pDONR223 100% 74% 77.2% None (many diffs) n/a
2 ccsbBroad304_04944 pLX_304 0% 74% 77.2% V5 (many diffs) n/a
3 TRCN0000476393 TAATTAACCGTTTGAACTGCAACT pLX_317 33.2% 74% 77.2% V5 (many diffs) n/a
Download CSV