Construct: ORF TRCN0000476516
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003136.1_s317c1
- Derived from:
- ccsbBroadEn_13810
- DNA Barcode:
- GACTAAACGACTGCCACTCTTAGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- AHCY (191)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476516
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 191 | AHCY | adenosylhomocysteinase | XM_017027710.2 | 99.8% | 99.6% | 908A>C |
| 2 | human | 191 | AHCY | adenosylhomocysteinase | NM_001161766.1 | 75.6% | 75.4% | 1_294del;1202A>C |
| 3 | human | 191 | AHCY | adenosylhomocysteinase | NM_001322084.2 | 75.6% | 75.4% | 1_294del;1202A>C |
| 4 | human | 191 | AHCY | adenosylhomocysteinase | NM_001322085.2 | 75.6% | 75.4% | 1_294del;1202A>C |
| 5 | human | 191 | AHCY | adenosylhomocysteinase | XM_005260317.2 | 75.6% | 75.4% | 1_294del;1202A>C |
| 6 | human | 191 | AHCY | adenosylhomocysteinase | XM_011528659.1 | 75.6% | 75.4% | 1_294del;1202A>C |
| 7 | human | 191 | AHCY | adenosylhomocysteinase | NM_000687.4 | 70.7% | 70.6% | 1_378del;1286A>C |
| 8 | human | 191 | AHCY | adenosylhomocysteinase | NM_001362750.2 | 70.7% | 70.6% | 1_378del;1286A>C |
| 9 | human | 191 | AHCY | adenosylhomocysteinase | XM_017027709.2 | 70.7% | 70.6% | 1_378del;1286A>C |
| 10 | human | 191 | AHCY | adenosylhomocysteinase | NM_001322086.2 | 70.4% | 70.2% | 1_384del;1292A>C |
| 11 | human | 191 | AHCY | adenosylhomocysteinase | XM_011528656.3 | 70.4% | 70.2% | 1_384del;1292A>C |
| 12 | human | 191 | AHCY | adenosylhomocysteinase | XM_011528657.2 | 70.4% | 70.2% | 1_384del;1292A>C |
| 13 | human | 191 | AHCY | adenosylhomocysteinase | XM_011528658.3 | 70.4% | 70.2% | 1_384del;1292A>C |
| 14 | mouse | 269378 | Ahcy | S-adenosylhomocysteine hydr... | NM_016661.3 | 64.6% | 68.7% | (many diffs) |
| 15 | mouse | 11615 | Gm4737 | predicted gene 4737 | NM_001304528.1 | 64.3% | 68.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 987
- ORF length:
- 918
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gattctggac gacgggggcg acctcaccaa cctcatccac accaagtacc 121 cgcagcttct gccaggcatc cgaggcatct ctgaggagac cacgactggg gtccacaacc 181 tctacaagat gatggccaat gggatcctca aggtgcctgc catcaatgtc aatgactccg 241 tcaccaagag caagtttgac aacctctatg gctgccggga gtccctcata gatggcatca 301 agcgggccac agatgtgatg attgccggca aggtagcggt ggtagcaggc tatggtgatg 361 tgggcaaggg ctgtgcccag gccctgcggg gtttcggagc ccgcgtcatc atcaccgaga 421 ttgaccccat caacgcactg caggctgcca tggagggcta tgaggtgacc accatggatg 481 aggcctgtca ggagggcaac atctttgtca ccaccacagg ctgtattgac atcatccttg 541 gccggCACTT TGAGCAGATG AAGGATGATG CCATTGTGTG TAACATTGGA CACTTTGACG 601 TGGAGATCGA TGTCAAGTGG CTCAACGAGA ACGCCGTGGA GAAGGTGAAC ATCAAGCCGC 661 AGGTGGACCG GTATCGGTTG AAGAATGGGC GCCGCATCAT CCTGCTGGCC GAGGGTCGGC 721 TGGTCAACCT GGGTTGTGCC ATGGGCCACC CCAGCTTCGT GATGAGTAAC TCCTTCACCA 781 ACCAGGTGAT GGCGCAGATC GAGCTGTGGA CCCATCCAGA CAAGTACCCC GTTGGGGTTC 841 ATTTCCTGCC CAAGAAGCTG GATGAGGCAG TGGCTGAAGC CCACCTGGGC AAGCTGAATG 901 TGAAGTTGAC CAAGCTAACT GAGAAGCAAG CCCAGTACCT GGGCATGTCC TGTGATGGCC 961 CCTTCAAGCC GGATCCCTAC CGCTACTTGC CAACTTTCTT GTACAAAGTG GTTGATATCG 1021 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1081 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAGACTAAAC 1141 GACTGCCACT CTTAGAACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1201 aagatt