Transcript: Mouse NM_001304528.1

Mus musculus predicted gene 4737 (Gm4737), mRNA.

Source:
NCBI, updated 2017-01-31
Taxon:
Mus musculus (mouse)
Gene:
Gm4737 (11615)
Length:
2093
CDS:
66..1364

Additional Resources:

NCBI RefSeq record:
NM_001304528.1
NBCI Gene record:
Gm4737 (11615)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001304528.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039209 CCATGCACCTTATCATTGATA pLKO.1 1657 3UTR 100% 5.625 3.375 N Ahcy n/a
2 TRCN0000304925 GTGGACCCACCCAGATAAATA pLKO_005 1181 CDS 100% 15.000 7.500 Y Ahcy n/a
3 TRCN0000349016 GAGCAAATGTCACCAACTTTG pLKO_005 1430 3UTR 100% 10.800 5.400 Y Ahcy n/a
4 TRCN0000349015 GATGGTGGTGACCTTACTAAC pLKO_005 456 CDS 100% 10.800 5.400 Y Ahcy n/a
5 TRCN0000050020 CGGGCCACAGATGTGATGATT pLKO.1 678 CDS 100% 5.625 2.813 Y AHCY n/a
6 TRCN0000050021 CCACAACCTCTACAAGATGAT pLKO.1 548 CDS 100% 4.950 2.475 Y AHCY n/a
7 TRCN0000039210 CGGTGGAGAAAGTGAACATCA pLKO.1 1009 CDS 100% 4.950 2.475 Y Ahcy n/a
8 TRCN0000302750 CGGTGGAGAAAGTGAACATCA pLKO_005 1009 CDS 100% 4.950 2.475 Y Ahcy n/a
9 TRCN0000039212 GCTCTGGATATAGCTGAGAAT pLKO.1 126 CDS 100% 4.950 2.475 Y Ahcy n/a
10 TRCN0000302751 GCTCTGGATATAGCTGAGAAT pLKO_005 126 CDS 100% 4.950 2.475 Y Ahcy n/a
11 TRCN0000039211 CCGAGTCATCATCACCGAGAT pLKO.1 776 CDS 100% 4.050 2.025 Y Ahcy n/a
12 TRCN0000039213 CCTGCCATCAATGTCAACGAT pLKO.1 591 CDS 100% 3.000 1.500 Y Ahcy n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304528.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00042 pDONR223 100% 90.6% 96.9% None (many diffs) n/a
2 ccsbBroad304_00042 pLX_304 0% 90.6% 96.9% V5 (many diffs) n/a
3 TRCN0000480477 AGCAATATTAAGGTTTTTTGGCGC pLX_317 34.3% 90.6% 96.9% V5 (many diffs) n/a
4 ccsbBroadEn_13810 pDONR223 100% 64.3% 68.7% None (many diffs) n/a
5 ccsbBroad304_13810 pLX_304 0% 64.3% 68.7% V5 (many diffs) n/a
6 TRCN0000476516 GACTAAACGACTGCCACTCTTAGA pLX_317 48% 64.3% 68.7% V5 (many diffs) n/a
Download CSV