Transcript: Human XM_011528656.3

PREDICTED: Homo sapiens adenosylhomocysteinase (AHCY), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AHCY (191)
Length:
1803
CDS:
106..1410

Additional Resources:

NCBI RefSeq record:
XM_011528656.3
NBCI Gene record:
AHCY (191)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528656.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218387 ATGCCATTGTGTGTAACATTG pLKO_005 989 CDS 100% 10.800 7.560 N AHCY n/a
2 TRCN0000229329 CCGTCACCAAGAGCAAGTTTG pLKO_005 659 CDS 100% 10.800 7.560 N AHCY n/a
3 TRCN0000229330 GTCAGGAGGGCAACATCTTTG pLKO_005 908 CDS 100% 10.800 7.560 N AHCY n/a
4 TRCN0000229328 TCAAGGTGCCTGCCATCAATG pLKO_005 629 CDS 100% 10.800 7.560 N AHCY n/a
5 TRCN0000050020 CGGGCCACAGATGTGATGATT pLKO.1 724 CDS 100% 5.625 3.938 N AHCY n/a
6 TRCN0000050022 CACAGGCTGTATTGACATCAT pLKO.1 936 CDS 100% 4.950 3.465 N AHCY n/a
7 TRCN0000050021 CCACAACCTCTACAAGATGAT pLKO.1 594 CDS 100% 4.950 3.465 N AHCY n/a
8 TRCN0000050018 GTGTGTAACATTGGACACTTT pLKO.1 997 CDS 100% 4.950 3.465 N AHCY n/a
9 TRCN0000050019 GATGAGTAACTCCTTCACCAA pLKO.1 1182 CDS 100% 2.640 1.848 N AHCY n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528656.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00042 pDONR223 100% 98.6% 97.9% None (many diffs) n/a
2 ccsbBroad304_00042 pLX_304 0% 98.6% 97.9% V5 (many diffs) n/a
3 TRCN0000480477 AGCAATATTAAGGTTTTTTGGCGC pLX_317 34.3% 98.6% 97.9% V5 (many diffs) n/a
4 ccsbBroadEn_13810 pDONR223 100% 70.4% 70.2% None 1_384del;1292A>C n/a
5 ccsbBroad304_13810 pLX_304 0% 70.4% 70.2% V5 1_384del;1292A>C n/a
6 TRCN0000476516 GACTAAACGACTGCCACTCTTAGA pLX_317 48% 70.4% 70.2% V5 1_384del;1292A>C n/a
Download CSV