Construct: ORF TRCN0000476558
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011655.1_s317c1
- Derived from:
- ccsbBroadEn_09675
- DNA Barcode:
- TTTCTCGCGACCAGTAGCAGATCA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- PUS10 (150962)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476558
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 150962 | PUS10 | pseudouridine synthase 10 | NM_001322123.1 | 99.9% | 63.7% | 1013C>A |
2 | human | 150962 | PUS10 | pseudouridine synthase 10 | NM_001322124.1 | 99.9% | 63.7% | 1013C>A |
3 | human | 150962 | PUS10 | pseudouridine synthase 10 | NM_144709.4 | 99.9% | 63.7% | 1013C>A |
4 | human | 150962 | PUS10 | pseudouridine synthase 10 | XM_011532568.3 | 99.9% | 63.7% | 1013C>A |
5 | human | 150962 | PUS10 | pseudouridine synthase 10 | XM_011532570.2 | 99.9% | 63.7% | 1013C>A |
6 | human | 150962 | PUS10 | pseudouridine synthase 10 | XM_011532571.2 | 99.9% | 63.7% | 1013C>A |
7 | human | 150962 | PUS10 | pseudouridine synthase 10 | XM_011532573.3 | 99.9% | 63.7% | 1013C>A |
8 | human | 150962 | PUS10 | pseudouridine synthase 10 | XM_011532574.3 | 99.9% | 63.7% | 1013C>A |
9 | human | 150962 | PUS10 | pseudouridine synthase 10 | XM_011532576.3 | 99.9% | 63.7% | 1013C>A |
10 | human | 150962 | PUS10 | pseudouridine synthase 10 | XM_024452720.1 | 99.9% | 63.7% | 1013C>A |
11 | human | 150962 | PUS10 | pseudouridine synthase 10 | XM_011532578.2 | 88% | 51.7% | 0_1ins189;824C>A |
12 | human | 150962 | PUS10 | pseudouridine synthase 10 | XM_017003428.2 | 83.8% | 47.6% | 123_124ins255;758C>A |
13 | human | 150962 | PUS10 | pseudouridine synthase 10 | XM_017003429.2 | 83.8% | 47.6% | 123_124ins255;758C>A |
14 | human | 150962 | PUS10 | pseudouridine synthase 10 | NM_001322127.1 | 57.7% | 20.9% | 0_1ins607;8_9ins62;344C>A |
15 | mouse | 74467 | Pus10 | pseudouridylate synthase 10 | NM_001033654.2 | 85.9% | 53.4% | (many diffs) |
16 | mouse | 74467 | Pus10 | pseudouridylate synthase 10 | NM_028304.2 | 85.9% | 53.4% | (many diffs) |
17 | mouse | 74467 | Pus10 | pseudouridylate synthase 10 | NM_028956.4 | 85.9% | 53.4% | (many diffs) |
18 | mouse | 74467 | Pus10 | pseudouridylate synthase 10 | XM_006514867.1 | 84% | 52.3% | (many diffs) |
19 | mouse | 74467 | Pus10 | pseudouridylate synthase 10 | XM_006514861.1 | 83.8% | 52.2% | (many diffs) |
20 | mouse | 74467 | Pus10 | pseudouridylate synthase 10 | XM_006514862.3 | 83.8% | 52.2% | (many diffs) |
21 | mouse | 74467 | Pus10 | pseudouridylate synthase 10 | XM_006514863.2 | 83.8% | 52.2% | (many diffs) |
22 | mouse | 74467 | Pus10 | pseudouridylate synthase 10 | XM_006514864.1 | 83.8% | 52.2% | (many diffs) |
23 | mouse | 74467 | Pus10 | pseudouridylate synthase 10 | XM_006514865.3 | 83.8% | 52.2% | (many diffs) |
24 | mouse | 74467 | Pus10 | pseudouridylate synthase 10 | XM_006514866.2 | 83.8% | 52.2% | (many diffs) |
25 | mouse | 74467 | Pus10 | pseudouridylate synthase 10 | XM_017314812.1 | 45.8% | 15.1% | (many diffs) |
26 | mouse | 74467 | Pus10 | pseudouridylate synthase 10 | XM_006514870.1 | 44.8% | 12.8% | (many diffs) |
27 | mouse | 74467 | Pus10 | pseudouridylate synthase 10 | XR_001780068.1 | 37.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1080
- ORF length:
- 1011
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gttcccactg actgaggaaa acaagcatgt ggcccagttg ttgctcaata 121 ctggtacttg tccaagatgt atcttcagat tctgtggtgt ggattttcat gcaccttaca 181 aacttccata caaggagttg ctcaatgaac tacagaaatt tctggaaact gaaaaagatg 241 aattaatttt ggaagttatg aacccacctc ccaagaaaat tcgactgcaa gaactggaag 301 atagtattga taatctaagt caaaatggag agggaaggat ctctgttagt catgttggaa 361 gcactgcttc caagaactca aatttaaatg tatgtaatgt atgcctagga attcttcaag 421 aattctgtga gaaagatttc attaaaaagg tgtgccaaaa ggttgaggcc tctgggtttg 481 aattcaccag cttggtattt tcagtctcct tcccaccaca actatctgta agagagcatg 541 ctgcatggtt gctggtaaaa caggaaatgg gaaagcagag tctgtcgctg ggaagagatg 601 atatagttca gctaaaagaa gcctacaaat ggataactca ccccctgttt tcagaggaac 661 tgggtgttcc cattgatgga aagagcttgt ttgaagtgag tgtggtcttt gctcacccag 721 aaacagttga ggattgccac ttcctagctg cgatatgccc agattgtttt aagccagcca 781 aaaacaaaca gtctgtattc actagaatgg cagttatgaa agccttgaat aagataaagg 841 aagaggattt ccttaagcag tttccttgtc ctccaaactc accaaaggct gtatgcgctg 901 ttcttgaaat tgaatgtgct catggtgctg tttttgtggc tgggagatat aataaatact 961 ccaggaatct accacaaact ccttggataa ttgatggaga aaggaagctg gaatcttcag 1021 tggaagaatt aatttcagat catctgttgg cagtatttaa agcagagagt tttaattttt 1081 aatcctctgg aagagaagat gtagatgtga gaacattagg aaatggaagg ccctttgcaa 1141 ttgagctggt gaatcctcat agagtacatt tcacttcaca agaaattaag gaacttcagc 1201 agaaaattaa taactcatct aacaaaatcc aagtacgtga cttgcagctt gtcacaagag 1261 aggcaatagg acatatgaaa gaaggtgaag aagaaaagac aaagacctac agtgccTTAA 1321 TTTGGACAAA TAAAGCGATA CAGAAGAAAG ACATTGAATT CCTAAATGAC ATAAAGGACT 1381 TAAAAATCGA CCAGAAAACA CCTTTGCGCG TCCTTCACCG AAGGCCCCTG GCTGTGCGAG 1441 CTCGCGTCAT TCACTTCATG GAGACACAGT ACGTGGATGA GCACCACTTC CGCCTCCACT 1501 TGAAAACTCA GGCTGGCACC TACATTAAAG AGTTTGTACA TGGAGACTTC GGGAGAACCA 1561 AGCCAAACAT TGGGTCCCTG ATGAATGTGA CTGCAGACAT TCTGGAGCTG GATGTTGAGT 1621 CTGTAGATGT TGACTGGCCA CCTGCTCTGG ATGACTTGCC AACTTTCTTG TACAAAGTGG 1681 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1741 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1801 ATTTCTCGCG ACCAGTAGCA GATCAACGCG TTAAGTCgac aatcaacctc tggattacaa 1861 aatttgtgaa agatt