Transcript: Human NM_001322123.1

Homo sapiens pseudouridine synthase 10 (PUS10), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
PUS10 (150962)
Length:
3792
CDS:
211..1800

Additional Resources:

NCBI RefSeq record:
NM_001322123.1
NBCI Gene record:
PUS10 (150962)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001322123.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420060 GCTTCCAAGAACTCAAATTTA pLKO_005 508 CDS 100% 15.000 21.000 N PUS10 n/a
2 TRCN0000435520 GCCACTTCCTAGCTGCGATAT pLKO_005 878 CDS 100% 10.800 15.120 N PUS10 n/a
3 TRCN0000138642 CCACCATAACGGTGTCTTGAA pLKO.1 1885 3UTR 100% 4.950 6.930 N PUS10 n/a
4 TRCN0000134616 GTTGTAACATCTCAGGATCTA pLKO.1 1945 3UTR 100% 4.950 6.930 N PUS10 n/a
5 TRCN0000414669 ATGCAGCATAATATCCTATAA pLKO_005 2231 3UTR 100% 13.200 9.240 N PUS10 n/a
6 TRCN0000426756 ATTCACTAGAATGGCAGTTAT pLKO_005 939 CDS 100% 13.200 9.240 N PUS10 n/a
7 TRCN0000138028 GAGCTGGATGTTGAGTCTGTA pLKO.1 1747 CDS 100% 4.950 3.465 N PUS10 n/a
8 TRCN0000133677 GCGATACAGAAGAAAGACATT pLKO.1 1477 CDS 100% 4.950 3.465 N PUS10 n/a
9 TRCN0000134366 GTGAATCCTCATAGAGTACAT pLKO.1 1291 CDS 100% 4.950 3.465 N PUS10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001322123.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09675 pDONR223 100% 99.9% 63.7% None 1013C>A n/a
2 ccsbBroad304_09675 pLX_304 0% 99.9% 63.7% V5 (not translated due to prior stop codon) 1013C>A n/a
3 TRCN0000476558 TTTCTCGCGACCAGTAGCAGATCA pLX_317 21.7% 99.9% 63.7% V5 (not translated due to prior stop codon) 1013C>A n/a
Download CSV