Transcript: Mouse XM_017314812.1

PREDICTED: Mus musculus pseudouridylate synthase 10 (Pus10), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pus10 (74467)
Length:
2840
CDS:
433..1323

Additional Resources:

NCBI RefSeq record:
XM_017314812.1
NBCI Gene record:
Pus10 (74467)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314812.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216556 GATCTATTTGTACGCATATTT pLKO.1 1475 3UTR 100% 15.000 12.000 N Pus10 n/a
2 TRCN0000241410 GATCTATTTGTACGCATATTT pLKO_005 1475 3UTR 100% 15.000 12.000 N Pus10 n/a
3 TRCN0000241408 TTGTCGCTGGCAGATATAATA pLKO_005 560 CDS 100% 15.000 10.500 N Pus10 n/a
4 TRCN0000190123 CGAGTGCATTTCACCTCACAA pLKO.1 787 CDS 100% 4.950 3.465 N Pus10 n/a
5 TRCN0000201983 CCTGGACGACTTAAAGGACTT pLKO.1 987 CDS 100% 4.050 2.835 N Pus10 n/a
6 TRCN0000241407 TTGGGTTCCTGGACGACTTAA pLKO_005 980 CDS 100% 13.200 7.920 N Pus10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314812.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09675 pDONR223 100% 45.8% 15.1% None (many diffs) n/a
2 ccsbBroad304_09675 pLX_304 0% 45.8% 15.1% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000476558 TTTCTCGCGACCAGTAGCAGATCA pLX_317 21.7% 45.8% 15.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV