Construct: ORF TRCN0000476641
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009455.1_s317c1
- Derived from:
- ccsbBroadEn_12324
- DNA Barcode:
- AGATCTCCGCTGCCCAGCCTATCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CABP4 (57010)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476641
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 57010 | CABP4 | calcium binding protein 4 | NM_001300895.2 | 100% | 100% | |
| 2 | human | 57010 | CABP4 | calcium binding protein 4 | NM_001300896.2 | 100% | 100% | |
| 3 | human | 57010 | CABP4 | calcium binding protein 4 | XM_011545183.2 | 100% | 100% | |
| 4 | human | 57010 | CABP4 | calcium binding protein 4 | XM_017018025.1 | 100% | 100% | |
| 5 | human | 57010 | CABP4 | calcium binding protein 4 | XM_024448616.1 | 100% | 100% | |
| 6 | human | 57010 | CABP4 | calcium binding protein 4 | NM_145200.4 | 60.8% | 55.3% | (many diffs) |
| 7 | human | 57010 | CABP4 | calcium binding protein 4 | XM_024448615.1 | 60.8% | 55.3% | (many diffs) |
| 8 | human | 57010 | CABP4 | calcium binding protein 4 | XM_011545182.2 | 58.6% | 35.4% | (many diffs) |
| 9 | human | 57010 | CABP4 | calcium binding protein 4 | XM_011545181.2 | 56.7% | 51.6% | (many diffs) |
| 10 | human | 57010 | CABP4 | calcium binding protein 4 | XM_005274114.3 | 25.3% | 17.8% | (many diffs) |
| 11 | mouse | 73660 | Cabp4 | calcium binding protein 4 | XM_017318298.1 | 78.7% | 80.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 576
- ORF length:
- 510
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac agagccgtgg ctggccctgg ggacatcctg gactctcccc ctgcaggacc 121 gcgaactggg ccccgaggag ctagacgagc ttcaggccgc cttcgaggag tttgacactg 181 accgtgacgg ctacatcagc caccgggagc tgggtgactg catgcggacc ctgggctaca 241 tgcccaccga gatggagctc ctggaggtct cgcagcacat caagatgcgc atgggcggcc 301 gtgtggactt TGAGGAGTTT GTAGAACTGA TAGGCCCAAA GCTGAGGGAG GAGACGGCGC 361 ACATGCTGGG GGTGCGAGAG CTGCGCATCG CCTTCCGAGA GTTTGACAGG GACAGGGATG 421 GACGAATTAC GGTGGCGGAG CTGCGGGAGG CGGTACCGGC TCTGCTCGGG GAGCCGCTGG 481 CGGGTCCTGA GCTGGACGAG ATGCTCCGAG AAGTGGACCT CAATGGGGAT GGCACCGTAG 541 ACTTTGACGA GTTTGTGATG ATGCTCTCCC GCCACTGCCC AACTTTCTTG TACAAAGTGG 601 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 661 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 721 AAGATCTCCG CTGCCCAGCC TATCAACGCG TTAAGTCgac aatcaacctc tggattacaa 781 aatttgtgaa agatt