Transcript: Mouse XM_017318298.1

PREDICTED: Mus musculus calcium binding protein 4 (Cabp4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cabp4 (73660)
Length:
1438
CDS:
401..874

Additional Resources:

NCBI RefSeq record:
XM_017318298.1
NBCI Gene record:
Cabp4 (73660)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318298.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071800 AGATCCCTAAAGGAGTTGTAT pLKO.1 102 5UTR 100% 5.625 7.875 N Cabp4 n/a
2 TRCN0000071798 ACGAGTTTGTAATGATGCTAT pLKO.1 843 CDS 100% 4.950 6.930 N Cabp4 n/a
3 TRCN0000056370 CGCATCGCCTTCCGAGAGTTT pLKO.1 680 CDS 100% 1.650 1.320 N CABP4 n/a
4 TRCN0000071799 CCCTTGCTCAACCGCATGTTT pLKO.1 386 5UTR 100% 5.625 3.938 N Cabp4 n/a
5 TRCN0000071801 CTGGATGAGATGTTGCGAGAA pLKO.1 788 CDS 100% 4.050 2.835 N Cabp4 n/a
6 TRCN0000071802 CCCACGGAGATGGAGCTTCTA pLKO.1 539 CDS 100% 1.650 1.155 N Cabp4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318298.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12324 pDONR223 100% 78.7% 80.5% None (many diffs) n/a
2 ccsbBroad304_12324 pLX_304 0% 78.7% 80.5% V5 (many diffs) n/a
3 TRCN0000476641 AGATCTCCGCTGCCCAGCCTATCA pLX_317 52% 78.7% 80.5% V5 (many diffs) n/a
Download CSV