Transcript: Human XM_024448615.1

PREDICTED: Homo sapiens calcium binding protein 4 (CABP4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CABP4 (57010)
Length:
6840
CDS:
2898..3725

Additional Resources:

NCBI RefSeq record:
XM_024448615.1
NBCI Gene record:
CABP4 (57010)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448615.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056369 CACCGTAGACTTTGACGAGTT pLKO.1 3680 CDS 100% 4.050 5.670 N CABP4 n/a
2 TRCN0000056372 TGTAGAACTGATAGGCCCAAA pLKO.1 3467 CDS 100% 4.050 5.670 N CABP4 n/a
3 TRCN0000056370 CGCATCGCCTTCCGAGAGTTT pLKO.1 3531 CDS 100% 1.650 2.310 N CABP4 n/a
4 TRCN0000414722 CCCTTCCACTACTTATGTTTA pLKO_005 4082 3UTR 100% 13.200 9.240 N CABP4 n/a
5 TRCN0000415919 GCCTCAATGTTGGCTTGTTAT pLKO_005 3865 3UTR 100% 13.200 9.240 N CABP4 n/a
6 TRCN0000437967 AGGCTCCAGGAGGGAATATCT pLKO_005 3725 CDS 100% 5.625 3.938 N CABP4 n/a
7 TRCN0000056368 GAGGAGTTTGTAGAACTGATA pLKO.1 3459 CDS 100% 4.950 3.465 N CABP4 n/a
8 TRCN0000056371 CCCGAGGAGCTAGACGAGCTT pLKO.1 3279 CDS 100% 0.000 0.000 N CABP4 n/a
9 TRCN0000447483 GGACAGGGATGGACGAATTAC pLKO_005 3557 CDS 100% 13.200 7.920 N CABP4 n/a
10 TRCN0000164978 GTGGTGGCTTATGCCTGTAAT pLKO.1 6089 3UTR 100% 13.200 6.600 Y C9orf139 n/a
11 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 899 5UTR 100% 4.950 2.475 Y CFLAR n/a
12 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 899 5UTR 100% 4.950 2.475 Y C19orf31 n/a
13 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 5341 3UTR 100% 4.950 2.475 Y ORAI2 n/a
14 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 4754 3UTR 100% 4.950 2.475 Y ERAP2 n/a
15 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 4822 3UTR 100% 13.200 6.600 Y IQCC n/a
16 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4755 3UTR 100% 13.200 6.600 Y LIAS n/a
17 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 5338 3UTR 100% 4.950 2.475 Y LOC339059 n/a
18 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5584 3UTR 100% 4.950 2.475 Y KAAG1 n/a
19 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 897 5UTR 100% 4.950 2.475 Y ERN2 n/a
20 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 897 5UTR 100% 4.950 2.475 Y P3H4 n/a
21 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 897 5UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448615.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12324 pDONR223 100% 60.8% 55.3% None (many diffs) n/a
2 ccsbBroad304_12324 pLX_304 0% 60.8% 55.3% V5 (many diffs) n/a
3 TRCN0000476641 AGATCTCCGCTGCCCAGCCTATCA pLX_317 52% 60.8% 55.3% V5 (many diffs) n/a
Download CSV