Transcript: Human XM_017018025.1

PREDICTED: Homo sapiens calcium binding protein 4 (CABP4), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CABP4 (57010)
Length:
1764
CDS:
683..1195

Additional Resources:

NCBI RefSeq record:
XM_017018025.1
NBCI Gene record:
CABP4 (57010)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018025.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056369 CACCGTAGACTTTGACGAGTT pLKO.1 1150 CDS 100% 4.050 5.670 N CABP4 n/a
2 TRCN0000056372 TGTAGAACTGATAGGCCCAAA pLKO.1 937 CDS 100% 4.050 5.670 N CABP4 n/a
3 TRCN0000056370 CGCATCGCCTTCCGAGAGTTT pLKO.1 1001 CDS 100% 1.650 2.310 N CABP4 n/a
4 TRCN0000414722 CCCTTCCACTACTTATGTTTA pLKO_005 1552 3UTR 100% 13.200 9.240 N CABP4 n/a
5 TRCN0000415919 GCCTCAATGTTGGCTTGTTAT pLKO_005 1335 3UTR 100% 13.200 9.240 N CABP4 n/a
6 TRCN0000437967 AGGCTCCAGGAGGGAATATCT pLKO_005 1195 CDS 100% 5.625 3.938 N CABP4 n/a
7 TRCN0000056368 GAGGAGTTTGTAGAACTGATA pLKO.1 929 CDS 100% 4.950 3.465 N CABP4 n/a
8 TRCN0000056371 CCCGAGGAGCTAGACGAGCTT pLKO.1 749 CDS 100% 0.000 0.000 N CABP4 n/a
9 TRCN0000447483 GGACAGGGATGGACGAATTAC pLKO_005 1027 CDS 100% 13.200 7.920 N CABP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018025.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12324 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12324 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476641 AGATCTCCGCTGCCCAGCCTATCA pLX_317 52% 100% 100% V5 n/a
Download CSV