Construct: ORF TRCN0000476767
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013573.1_s317c1
- Derived from:
- ccsbBroadEn_04492
- DNA Barcode:
- GCCGCCCAATAAGCGACATATATC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ARHGAP11B (89839)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476767
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 89839 | ARHGAP11B | Rho GTPase activating prote... | NM_001039841.2 | 100% | 100% | |
| 2 | human | 9824 | ARHGAP11A | Rho GTPase activating prote... | NM_199357.2 | 52.7% | 44.1% | (many diffs) |
| 3 | human | 114118903 | ARHGAP11A-SCG5 | ARHGAP11A-SCG5 readthrough | NM_001368319.1 | 42.2% | 35.5% | (many diffs) |
| 4 | human | 89839 | ARHGAP11B | Rho GTPase activating prote... | NR_148423.1 | 29.3% | 1_673del;1475_2727del | |
| 5 | human | 9824 | ARHGAP11A | Rho GTPase activating prote... | NM_014783.6 | 25.8% | 21.8% | (many diffs) |
| 6 | mouse | 228482 | Arhgap11a | Rho GTPase activating prote... | NM_181416.3 | 23.2% | 18.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 870
- ORF length:
- 801
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtgggatcag aggctggtga agttggccct gttgcagcat ctgcgggcct 121 tctatggtat taaggtgaag ggtgtccgtg ggcagtgcga tcgcaggaga catgaaacag 181 cagccacgga aatagggggt aaaatatttg gagtaccttt taatgcactg ccccattctg 241 ctgtaccaga atatggacac attccaagct ttcttgtcga tgcttgcaca tctttagaag 301 aacatattca taccgaaggg ctttttcgga aatcaggatc tgtgattcgc ctaaaagcac 361 taaagaataa agtggatcat ggtgaaggtt gcctatcttc tgcacctcct tgtgatattg 421 cgggacttct taagcagttt tttagggaac tgccagagcc cattcTCCCA GCTGATTTGC 481 ATGAAGCACT TTTGAAAGCT CAACAGTTAG GCACAGAGGA AAAGAATAAA GCTATACTGT 541 TGCTCTCCTG TCTTCTGGCT GACCACACAG TTCATGTATT AAGATACTTC TTTAACTTTC 601 TCAGGAATGT TTCTCTTAGA TCCAGTGAGA ATAAGATGGA TAGCAGCAAT CTTGCAGTAA 661 TATTTGCACC AAATCTTCTT CAGACAAGTG AAGGACATGA AAAGATGTCT TCTAACGCAG 721 AAAAGAAGGG CGTGTACCAG ACTTTATCCT GGAAAAGATA CCAGCCATGT TGGGTATTGA 781 TGGTCTCTGT GCTACTCCAT CACTGGAAGG CTTTGAAGAA GGTGAATATG AAACTCCTGG 841 TGAATATAAG AGAAAGAGAA GACAACGTGT TGCCAACTTT CTTGTACAAA GTGGTTGATA 901 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 961 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAGCCGC 1021 CCAATAAGCG ACATATATCA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1081 tgaaagatt