Transcript: Human NM_014783.6

Homo sapiens Rho GTPase activating protein 11A (ARHGAP11A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ARHGAP11A (9824)
Length:
5876
CDS:
709..3780

Additional Resources:

NCBI RefSeq record:
NM_014783.6
NBCI Gene record:
ARHGAP11A (9824)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014783.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429331 GAAGATCTCTGCGTTTGAAAT pLKO_005 2003 CDS 100% 13.200 9.240 N ARHGAP11A n/a
2 TRCN0000047280 CTGGTGTCAATAGATATGAAA pLKO.1 2063 CDS 100% 5.625 3.938 N ARHGAP11A n/a
3 TRCN0000241874 AGCAATCTTGCAGTAATATTT pLKO_005 1285 CDS 100% 15.000 7.500 Y ARHGAP11B n/a
4 TRCN0000193495 GCAGCAATCTTGCAGTAATAT pLKO.1 1283 CDS 100% 15.000 7.500 Y Arhgap11a n/a
5 TRCN0000241876 CGGGCCTTCTATGGTATTAAG pLKO_005 754 CDS 100% 13.200 6.600 Y ARHGAP11B n/a
6 TRCN0000241877 GAAACAGCAGCCACGGAAATA pLKO_005 814 CDS 100% 13.200 6.600 Y ARHGAP11B n/a
7 TRCN0000241875 GTCGATGCTTGCACATCTTTA pLKO_005 916 CDS 100% 13.200 6.600 Y ARHGAP11B n/a
8 TRCN0000426755 TATTGGGCGTGTACCAGATTT pLKO_005 1419 CDS 100% 13.200 6.600 Y ARHGAP11A n/a
9 TRCN0000412549 TTTGAGCTGTTGCCAAGTAAT pLKO_005 1762 CDS 100% 13.200 6.600 Y ARHGAP11A n/a
10 TRCN0000431066 AGTACAGACTCTTATCGATTA pLKO_005 1389 CDS 100% 10.800 5.400 Y ARHGAP11A n/a
11 TRCN0000435697 CCAAATGCTAAGCGTACATTG pLKO_005 1678 CDS 100% 10.800 5.400 Y ARHGAP11A n/a
12 TRCN0000047278 CCAGCCATGTTGGGTATTGAT pLKO.1 1456 CDS 100% 5.625 2.813 Y ARHGAP11A n/a
13 TRCN0000047282 CCTTCTATTACACCTCAAGAA pLKO.1 1615 CDS 100% 4.950 2.475 Y ARHGAP11A n/a
14 TRCN0000047281 CGGTATCAGTTCACATCGATA pLKO.1 1805 CDS 100% 4.950 2.475 Y ARHGAP11A n/a
15 TRCN0000047279 GCTATCTGAATCACCAGTGAT pLKO.1 1650 CDS 100% 4.950 2.475 Y ARHGAP11A n/a
16 TRCN0000241873 TACCAGCCATGTTGGGTATTG pLKO_005 1454 CDS 100% 0.000 0.000 Y ARHGAP11B n/a
17 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4263 3UTR 100% 5.625 2.813 Y KLHL30 n/a
18 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4263 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014783.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02252 pDONR223 100% 48.8% 48.3% None (many diffs) n/a
2 ccsbBroad304_02252 pLX_304 0% 48.8% 48.3% V5 (many diffs) n/a
3 TRCN0000471329 AAATCCCTTTCATCGTTGACCCCC pLX_317 24.2% 48.8% 48.3% V5 (many diffs) n/a
4 ccsbBroadEn_04492 pDONR223 100% 25.8% 21.8% None (many diffs) n/a
5 ccsbBroad304_04492 pLX_304 0% 25.8% 21.8% V5 (many diffs) n/a
6 TRCN0000476767 GCCGCCCAATAAGCGACATATATC pLX_317 50.3% 25.8% 21.8% V5 (many diffs) n/a
Download CSV