Transcript: Mouse NM_181416.3

Mus musculus Rho GTPase activating protein 11A (Arhgap11a), mRNA.

Source:
NCBI, updated 2019-02-17
Taxon:
Mus musculus (mouse)
Gene:
Arhgap11a (228482)
Length:
5017
CDS:
573..3536

Additional Resources:

NCBI RefSeq record:
NM_181416.3
NBCI Gene record:
Arhgap11a (228482)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_181416.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193495 GCAGCAATCTTGCAGTAATAT pLKO.1 1147 CDS 100% 15.000 21.000 N Arhgap11a n/a
2 TRCN0000193496 GCTCGTCATCAGTGTAAATAA pLKO.1 3553 3UTR 100% 15.000 12.000 N Arhgap11a n/a
3 TRCN0000241874 AGCAATCTTGCAGTAATATTT pLKO_005 1149 CDS 100% 15.000 10.500 N ARHGAP11B n/a
4 TRCN0000193331 CCAAAGTCAGTCGTAAAGAAA pLKO.1 1834 CDS 100% 5.625 3.938 N Arhgap11a n/a
5 TRCN0000193632 CCTTTGGATGATCTCACGAAT pLKO.1 3345 CDS 100% 4.950 3.465 N Arhgap11a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181416.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04492 pDONR223 100% 23.2% 18.9% None (many diffs) n/a
2 ccsbBroad304_04492 pLX_304 0% 23.2% 18.9% V5 (many diffs) n/a
3 TRCN0000476767 GCCGCCCAATAAGCGACATATATC pLX_317 50.3% 23.2% 18.9% V5 (many diffs) n/a
Download CSV