Transcript: Human NM_001039841.2

Homo sapiens Rho GTPase activating protein 11B (ARHGAP11B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
ARHGAP11B (89839)
Length:
1573
CDS:
674..1477

Additional Resources:

NCBI RefSeq record:
NM_001039841.2
NBCI Gene record:
ARHGAP11B (89839)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001039841.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241874 AGCAATCTTGCAGTAATATTT pLKO_005 1250 CDS 100% 15.000 7.500 Y ARHGAP11B n/a
2 TRCN0000193495 GCAGCAATCTTGCAGTAATAT pLKO.1 1248 CDS 100% 15.000 7.500 Y Arhgap11a n/a
3 TRCN0000241876 CGGGCCTTCTATGGTATTAAG pLKO_005 719 CDS 100% 13.200 6.600 Y ARHGAP11B n/a
4 TRCN0000241877 GAAACAGCAGCCACGGAAATA pLKO_005 779 CDS 100% 13.200 6.600 Y ARHGAP11B n/a
5 TRCN0000241875 GTCGATGCTTGCACATCTTTA pLKO_005 881 CDS 100% 13.200 6.600 Y ARHGAP11B n/a
6 TRCN0000047278 CCAGCCATGTTGGGTATTGAT pLKO.1 1366 CDS 100% 5.625 2.813 Y ARHGAP11A n/a
7 TRCN0000241873 TACCAGCCATGTTGGGTATTG pLKO_005 1364 CDS 100% 0.000 0.000 Y ARHGAP11B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039841.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04492 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04492 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476767 GCCGCCCAATAAGCGACATATATC pLX_317 50.3% 100% 100% V5 n/a
4 ccsbBroadEn_02252 pDONR223 100% 52.7% 44.1% None (many diffs) n/a
5 ccsbBroad304_02252 pLX_304 0% 52.7% 44.1% V5 (many diffs) n/a
6 TRCN0000471329 AAATCCCTTTCATCGTTGACCCCC pLX_317 24.2% 52.7% 44.1% V5 (many diffs) n/a
Download CSV