Construct: ORF TRCN0000476886
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016295.1_s317c1
- Derived from:
- ccsbBroadEn_07939
- DNA Barcode:
- AGAAAACGGTCTCCACATATTAAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RASGRP3 (25780)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476886
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 25780 | RASGRP3 | RAS guanyl releasing protein 3 | NM_001139488.2 | 99.9% | 99.8% | 2062G>A |
| 2 | human | 25780 | RASGRP3 | RAS guanyl releasing protein 3 | NM_001349975.2 | 99.9% | 99.8% | 2062G>A |
| 3 | human | 25780 | RASGRP3 | RAS guanyl releasing protein 3 | NM_001349976.2 | 99.9% | 99.8% | 2062G>A |
| 4 | human | 25780 | RASGRP3 | RAS guanyl releasing protein 3 | NM_001349977.2 | 99.9% | 99.8% | 2062G>A |
| 5 | human | 25780 | RASGRP3 | RAS guanyl releasing protein 3 | NM_170672.3 | 99.9% | 99.8% | 2062G>A |
| 6 | human | 25780 | RASGRP3 | RAS guanyl releasing protein 3 | XM_011532746.3 | 99.9% | 99.8% | 2062G>A |
| 7 | human | 25780 | RASGRP3 | RAS guanyl releasing protein 3 | XM_011532748.3 | 99.9% | 99.8% | 2062G>A |
| 8 | human | 25780 | RASGRP3 | RAS guanyl releasing protein 3 | XM_017003759.2 | 99.9% | 99.8% | 2062G>A |
| 9 | human | 25780 | RASGRP3 | RAS guanyl releasing protein 3 | XM_017003761.2 | 99.9% | 99.8% | 2062G>A |
| 10 | human | 25780 | RASGRP3 | RAS guanyl releasing protein 3 | NM_001349978.2 | 99.8% | 99.7% | 1160_1161insGCA;2059G>A |
| 11 | human | 25780 | RASGRP3 | RAS guanyl releasing protein 3 | NM_001349979.2 | 99.8% | 99.7% | 1160_1161insGCA;2059G>A |
| 12 | human | 25780 | RASGRP3 | RAS guanyl releasing protein 3 | NM_001349980.2 | 99.8% | 99.7% | 1160_1161insGCA;2059G>A |
| 13 | human | 25780 | RASGRP3 | RAS guanyl releasing protein 3 | NM_001349981.2 | 99.8% | 99.7% | 1160_1161insGCA;2059G>A |
| 14 | human | 25780 | RASGRP3 | RAS guanyl releasing protein 3 | NM_015376.2 | 99.8% | 99.7% | 1160_1161insGCA;2059G>A |
| 15 | human | 25780 | RASGRP3 | RAS guanyl releasing protein 3 | XR_001738692.2 | 56.1% | (many diffs) | |
| 16 | human | 25780 | RASGRP3 | RAS guanyl releasing protein 3 | XR_001738691.2 | 52% | (many diffs) | |
| 17 | human | 25780 | RASGRP3 | RAS guanyl releasing protein 3 | XR_001738693.2 | 42.1% | (many diffs) | |
| 18 | mouse | 240168 | Rasgrp3 | RAS, guanyl releasing prote... | NM_001166493.1 | 89% | 94% | (many diffs) |
| 19 | mouse | 240168 | Rasgrp3 | RAS, guanyl releasing prote... | NM_207246.4 | 89% | 94% | (many diffs) |
| 20 | mouse | 240168 | Rasgrp3 | RAS, guanyl releasing prote... | XM_006524271.3 | 89% | 94% | (many diffs) |
| 21 | mouse | 240168 | Rasgrp3 | RAS, guanyl releasing prote... | XM_006524272.3 | 89% | 94% | (many diffs) |
| 22 | mouse | 240168 | Rasgrp3 | RAS, guanyl releasing prote... | XM_006524273.3 | 88.8% | 93.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2136
- ORF length:
- 2070
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg atcaagtggc cttgggaaag cagcaacatt agatgaactg ctgtgcactt 121 gcattgagat gtttgatgac aatggagagc tggataatag ttatttgcca agaatagttc 181 tactgatgca ccgatggtat ttatcttcca ctgaattggc agaaaaactt ctctgcatgt 241 atcgaaatgc cactggagaa agctgcaatg aatttcgatt aaagatctgc tacttcatga 301 ggtactggat tctgaagttt cctgcagagt ttaatttgga tcttggtttg attcgtatga 361 ctgaggaatt tcgggaagta gctagtcaac taggatatga aaaacacgtc agcctcatcg 421 acatatccag cattccttcc tatgactgga tgagaagagt cacacagagg aaaaaagtat 481 ccaagaaggg aaaagcctgt ctgctgtttg accatctgga gcccattgaa ttggctgagc 541 acctcacttt tctggagcat aaatctttta gaaggatctc attcactgat taccaaagct 601 atgtcatcca tggctgcctg gagaataatc caaccttgga aagatcgatt gctttattta 661 atggaatctc taagtgggtc cagttgatgg ttcttagcaa accaaccccc cagcaaaggg 721 cagaagtcat cacaaagttt atcaatgttg caaagaagct ccttcagctc aaaaatttta 781 acaccctgat ggcagtggtg ggaggcctca gtcatagttc catttcacgc ctcaaagaga 841 cccattctca tctttcttca gaagttacaa agaactggaa tgaaatgaca gagttggtct 901 cctccaacgg caattactgc aattaccgca aggcctttgc cgactgcgat ggcttcaaaa 961 tccccatcct tggagtacac ttgaaagact tgatagctgt ccatgtcatt ttcccagact 1021 ggacagagga gaacaaagtg aacattgtga aaatgcacca gctctccgtt accctgagtg 1081 aactagtctc cctgcagaat gcctctcacc acttagaacc caacatggat ttgatcaacc 1141 tgctcacgct ttccctggac ctctatcaca ctgaagatga tatttacaaa ctgtcactgg 1201 tgctggagcc tagaaattct aaatcgcagc ctacctcccc tacgacgccc aacaagcctg 1261 tggtacccct ggagtgggca ttaggggtga tgccaaagcc agaccccacg gtcatcaaca 1321 agcacataag gaaattagtg gagtctgtat ttagaaacta tgatcacgac catgatgggt 1381 acatttccca agaggacttt gaaagtatag ctgccaattt tcccttcttg gattccttct 1441 gtgttctgga caaagatcag gatggcctaa ttagtaaaga tgaaatgatg gcttacttcc 1501 tgagagctaa atcccaacta cactgtaaaa tgggaccagg atttatccat aattttcagg 1561 agatgaccta tctcaagcca accttctgcg aacactgtgc gggatttctc tggggcataa 1621 tcaagcaagg atacaaatgc aaagactgtg gagccaattg tcacaaacag tgcaaagacc 1681 tcctggttct ggcctgcagg agatttgccc gggcgccctc cttGAGCAGT GGTCATGGGT 1741 CACTGCCTGG AAGCCCCTCG CTGCCCCCAG CGCAGGATGA GGTGTTTGAG TTCCCTGGAG 1801 TCACTGCTGG ACACAGGGAT TTAGACAGCA GAGCCATCAC ACTGGTTACA GGCTCTTCTC 1861 GCAAGATCTC TGTGAGGCTA CAGAGGGCCA CCACCAGCCA GGCCACCCAG ACTGAACCTG 1921 TCTGGTCAGA GGCTGGCTGG GGGGACTCGG GGTCCCACAC CTTCCCTAAA ATGAAATCCA 1981 AGTTCCATGA CAAAGCAGCA AAGGACAAAG GCTTTGCCAA ATGGGAAAAT GAGAAGCCCA 2041 GGGTGCATGC TGGTGTGGAT GTTGTAGACC GGGGCACGGA GTTTGAACTT GACCAGGATG 2101 AAGGAGAAGA GACCAGACAG GATGGTAAGG ATGGCTGCCC AACTTTCTTG TACAAAGTGG 2161 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 2221 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 2281 AAGAAAACGG TCTCCACATA TTAAGACGCG TTAAGTCgac aatcaacctc tggattacaa 2341 aatttgtgaa agatt