Transcript: Mouse XM_006524272.3

PREDICTED: Mus musculus RAS, guanyl releasing protein 3 (Rasgrp3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rasgrp3 (240168)
Length:
4741
CDS:
463..2538

Additional Resources:

NCBI RefSeq record:
XM_006524272.3
NBCI Gene record:
Rasgrp3 (240168)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524272.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360939 TGCGAACACTGTGCGGGATTT pLKO_005 1984 CDS 100% 10.800 15.120 N Rasgrp3 n/a
2 TRCN0000422968 TGCGAACACTGTGCGGGATTT pLKO_005 1984 CDS 100% 10.800 15.120 N RASGRP3 n/a
3 TRCN0000367958 CTGATGCACCGATGGTATTTA pLKO_005 580 CDS 100% 15.000 10.500 N Rasgrp3 n/a
4 TRCN0000367957 AGATCAGGACGGCCTAATTAG pLKO_005 1851 CDS 100% 13.200 9.240 N Rasgrp3 n/a
5 TRCN0000022730 CCAATGGCAATTACTGCAATT pLKO.1 1301 CDS 100% 10.800 7.560 N Rasgrp3 n/a
6 TRCN0000022731 GCTTATTTCCTGAGAGCTAAA pLKO.1 1888 CDS 100% 10.800 7.560 N Rasgrp3 n/a
7 TRCN0000022729 GCAGAGTTTAATTTGGATCTT pLKO.1 721 CDS 100% 4.950 3.465 N Rasgrp3 n/a
8 TRCN0000022733 GCTGGTGTGGATGTTGTAGAT pLKO.1 2446 CDS 100% 4.950 3.465 N Rasgrp3 n/a
9 TRCN0000022732 GCCTGCCTCTTATTTGACCAT pLKO.1 892 CDS 100% 2.640 1.848 N Rasgrp3 n/a
10 TRCN0000067688 CCTGAGTTCAATTCCTAGCAA pLKO.1 3917 3UTR 100% 3.000 1.500 Y Cd163 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524272.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07939 pDONR223 100% 89% 94% None (many diffs) n/a
2 ccsbBroad304_07939 pLX_304 0% 89% 94% V5 (many diffs) n/a
3 TRCN0000476886 AGAAAACGGTCTCCACATATTAAG pLX_317 20.2% 89% 94% V5 (many diffs) n/a
Download CSV