Transcript: Human NM_001349981.2

Homo sapiens RAS guanyl releasing protein 3 (RASGRP3), transcript variant 10, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
RASGRP3 (25780)
Length:
4383
CDS:
320..2389

Additional Resources:

NCBI RefSeq record:
NM_001349981.2
NBCI Gene record:
RASGRP3 (25780)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001349981.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048115 CGGTCATCAACAAGCACATAA pLKO.1 1560 CDS 100% 13.200 18.480 N RASGRP3 n/a
2 TRCN0000048113 GCTGCAATGAATTTCGATTAA pLKO.1 516 CDS 100% 13.200 18.480 N RASGRP3 n/a
3 TRCN0000048116 CCAACGGCAATTACTGCAATT pLKO.1 1158 CDS 100% 10.800 15.120 N RASGRP3 n/a
4 TRCN0000048114 GCCTCAGTCATAGTTCCATTT pLKO.1 1059 CDS 100% 10.800 15.120 N RASGRP3 n/a
5 TRCN0000022729 GCAGAGTTTAATTTGGATCTT pLKO.1 578 CDS 100% 4.950 6.930 N Rasgrp3 n/a
6 TRCN0000367958 CTGATGCACCGATGGTATTTA pLKO_005 437 CDS 100% 15.000 10.500 N Rasgrp3 n/a
7 TRCN0000416206 ACGTCAGCCTCATCGACATAT pLKO_005 660 CDS 100% 13.200 9.240 N RASGRP3 n/a
8 TRCN0000433718 AGATCAGGATGGCCTAATTAG pLKO_005 1705 CDS 100% 13.200 9.240 N RASGRP3 n/a
9 TRCN0000418526 GACCCTAACTAACTAACTATG pLKO_005 2558 3UTR 100% 10.800 7.560 N RASGRP3 n/a
10 TRCN0000360939 TGCGAACACTGTGCGGGATTT pLKO_005 1838 CDS 100% 10.800 7.560 N Rasgrp3 n/a
11 TRCN0000422968 TGCGAACACTGTGCGGGATTT pLKO_005 1838 CDS 100% 10.800 7.560 N RASGRP3 n/a
12 TRCN0000048117 GCTAGTCAACTAGGATATGAA pLKO.1 635 CDS 100% 5.625 3.938 N RASGRP3 n/a
13 TRCN0000022733 GCTGGTGTGGATGTTGTAGAT pLKO.1 2300 CDS 100% 4.950 3.465 N Rasgrp3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001349981.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07939 pDONR223 100% 99.8% 99.7% None 1160_1161insGCA;2059G>A n/a
2 ccsbBroad304_07939 pLX_304 0% 99.8% 99.7% V5 1160_1161insGCA;2059G>A n/a
3 TRCN0000476886 AGAAAACGGTCTCCACATATTAAG pLX_317 20.2% 99.8% 99.7% V5 1160_1161insGCA;2059G>A n/a
Download CSV