Construct: ORF TRCN0000476908
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014506.1_s317c1
- Derived from:
- ccsbBroadEn_09801
- DNA Barcode:
- CCGCGGGCTGTCACTCGCTTACGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SLC5A9 (200010)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476908
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 200010 | SLC5A9 | solute carrier family 5 mem... | NM_001011547.3 | 99.9% | 99.8% | 807T>G |
| 2 | human | 200010 | SLC5A9 | solute carrier family 5 mem... | NM_001135181.2 | 96.4% | 96.3% | 340_414del;882T>G |
| 3 | human | 200010 | SLC5A9 | solute carrier family 5 mem... | XM_011540924.2 | 87.8% | 87.7% | 340_531del;999T>G;1011_1012ins78 |
| 4 | human | 200010 | SLC5A9 | solute carrier family 5 mem... | XM_011540926.3 | 84.8% | 74.6% | (many diffs) |
| 5 | human | 200010 | SLC5A9 | solute carrier family 5 mem... | XM_011540927.1 | 83.2% | 67.7% | (many diffs) |
| 6 | human | 200010 | SLC5A9 | solute carrier family 5 mem... | XM_011540925.2 | 82.5% | 82.2% | (many diffs) |
| 7 | human | 200010 | SLC5A9 | solute carrier family 5 mem... | XM_011540928.1 | 69.7% | 69.6% | 0_1ins618;189T>G |
| 8 | human | 200010 | SLC5A9 | solute carrier family 5 mem... | XM_017000558.1 | 68.6% | 65.9% | (many diffs) |
| 9 | human | 200010 | SLC5A9 | solute carrier family 5 mem... | XM_011540929.2 | 53.9% | 51.5% | (many diffs) |
| 10 | human | 200010 | SLC5A9 | solute carrier family 5 mem... | XR_946573.2 | 50.3% | (many diffs) | |
| 11 | mouse | 230612 | Slc5a9 | solute carrier family 5 (so... | NM_145551.4 | 83.6% | 84.7% | (many diffs) |
| 12 | mouse | 230612 | Slc5a9 | solute carrier family 5 (so... | XM_006503000.2 | 83.6% | 84.7% | (many diffs) |
| 13 | mouse | 230612 | Slc5a9 | solute carrier family 5 (so... | XR_376307.3 | 52% | (many diffs) | |
| 14 | mouse | 230612 | Slc5a9 | solute carrier family 5 (so... | XM_006503002.3 | 48.6% | 50.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2112
- ORF length:
- 2043
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gagcaaggag ctggcagcaa tggggcctgg agcttcaggg gacggggtca 121 ggactgagac agctccacac atagcactgg actccagagt tggtctgcac gcctacgaca 181 tcagcgtggt ggtcatctac tttgtcttcg tcattgctgt ggggatctgg tcgtccatcc 241 gtgcaagtcg agggaccatt ggcggctatt tcctggccgg gaggtccatg agctggtggc 301 caattggagc atctctgatg tccagcaatg tgggcagtgg cttgttcatc ggcctggctg 361 ggacaggggc tgccggaggc cttgccgtag gtggcttcga gtggaacgca acctggctgc 421 tcctggccct tggctgggtc ttcgtccctg tgtacatcgc agcaggtgtg gtcacaatgc 481 cgcagtatct gaagaagcga tttgggggcc agaggatcca ggtgtacatg tctgtcctgt 541 ctctcatcct ctacatcttc accaagatct cgactgacat cttctctgga gccctcttca 601 tccagatggc attgggctgg aacctgtacc tctccacagg gatcctgctg gtggtgactg 661 ccgtctacac cattgcaggt ggcctcatgg ccgtgatcta cacagatgct ctgcagacgg 721 tgatcatggt agggggagcc ctggtcctca tgtttctggg ctttcaggac gtgggctggt 781 acccaggcct ggagcagcgg tacaggcagg ccatccctaa tgtcacagtc cccaacacca 841 cctgtcacct cccacggccc gatgctttcc acatgcttcg ggaccctgtg agcggggaca 901 tcccttggcc aggtctcatt ttcgggctca cagtgctggc cacctggtgt tggtgcacag 961 accaggtcat tgtgcagcgg tctctctcgg ccaagagtct gtctcatgcc aagggaggct 1021 ccgtgctggg gggctacctg aagatcctcc ccatgttctt catcgtcatg cctggcatga 1081 tcagccgggc cctgttccca gacgaggtgg gctgcgtgga ccctgatgtc tgccaaagaa 1141 tctgtggggc ccgagtggga tgttccaaca ttgcctaccc taagttggtc atggccctca 1201 tgcctgttgg tctgcggggg ctgatgattg ccgtgatcat ggccgctctc atgagctcac 1261 tcacctccat cttcaacagc agcagcaccc tgttcaccat tgatgtgtgg cagcgcttcc 1321 gcaggaagtc aacagagcag gagctgatgg tggtgggcag agtgtttgtg gtgttcctgg 1381 ttgtcatcag catcctctgg atccccatca tccaaagctc caacagtggg cagctcttcg 1441 actacatcca ggctgtcacc agttacctgg ccccacccat caccgctctc ttcctgctgg 1501 ccatcttctg caagagggtc acagagcccg gagctttctg gggcctcgtg tttggcctgg 1561 gagtggggct tctgcgtatg atcctggagt tctcataccc agcgccagcc tgtggggagg 1621 tggaccggag gccagcagtg ctgaaggact tccactacct gtactttgca atcctcctct 1681 gcgggctcac tgccatcgtc attgtcattg tcagcctctg tacaactccc atccctgagg 1741 aacagctcac acgcctcaca tggtggactc ggaactgccc cctctctgag ctggagaagg 1801 aggcccacga gagcacaccg gagatatccg agaggccagc cggggagtgc cctgcaggag 1861 gtggagcggc agagaactcg agcctgggcc aggagcagcc tgaagcccca agcaggtcct 1921 ggggaaagtt gctctggagc tggttctgtg ggctcTCTGG AACACCGGAG CAGGCCCTGA 1981 GCCCAGCAGA GAAGGCTGCG CTAGAACAGA AGCTGACAAG CATTGAGGAG GAGCCACTCT 2041 GGAGACATGT CTGCAACATC AATGCTGTCC TTTTGCTGGC CATCAACATC TTCCTCTGGG 2101 GCTATTTTGC GTTGCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 2161 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 2221 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGACCG CGGGCTGTCA CTCGCTTACG 2281 AACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t