Transcript: Mouse XM_006503002.3

PREDICTED: Mus musculus solute carrier family 5 (sodium/glucose cotransporter), member 9 (Slc5a9), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc5a9 (230612)
Length:
1362
CDS:
140..1279

Additional Resources:

NCBI RefSeq record:
XM_006503002.3
NBCI Gene record:
Slc5a9 (230612)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503002.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079212 CAGTACCTGAAGAAACGATTT pLKO.1 542 CDS 100% 10.800 8.640 N Slc5a9 n/a
2 TRCN0000079210 CCAGAGTTGGATGCTCCAATA pLKO.1 1209 CDS 100% 10.800 7.560 N Slc5a9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503002.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09801 pDONR223 100% 48.6% 50.6% None (many diffs) n/a
2 ccsbBroad304_09801 pLX_304 0% 48.6% 50.6% V5 (many diffs) n/a
3 TRCN0000476908 CCGCGGGCTGTCACTCGCTTACGA pLX_317 8% 48.6% 50.6% V5 (many diffs) n/a
4 TRCN0000489564 GTGATGCAAAAGTTTCGGTATTGC pLX_317 14.2% 46.8% 48.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV