Transcript: Human NR_158991.1

Homo sapiens iodothyronine deiodinase 2 (DIO2), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DIO2 (1734)
Length:
6259
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_158991.1
NBCI Gene record:
DIO2 (1734)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_158991.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294313 GTATTGCCTTGGCTCTATTTG pLKO_005 1486 3UTR 100% 13.200 18.480 N DIO2 n/a
2 TRCN0000084063 GCTCTCTATGACTCGGTCATT pLKO.1 108 3UTR 100% 4.950 6.930 N DIO2 n/a
3 TRCN0000286958 GCTCTCTATGACTCGGTCATT pLKO_005 108 3UTR 100% 4.950 6.930 N DIO2 n/a
4 TRCN0000084065 GCCTTTGAACGTGTGTGCATT pLKO.1 950 3UTR 100% 4.950 3.960 N DIO2 n/a
5 TRCN0000286957 GCCTTTGAACGTGTGTGCATT pLKO_005 950 3UTR 100% 4.950 3.960 N DIO2 n/a
6 TRCN0000294370 GCTGGTTAAAGGTATGATTAT pLKO_005 1088 3UTR 100% 13.200 9.240 N DIO2 n/a
7 TRCN0000084064 CCCTTCTCCTACAACCTTCAA pLKO.1 1010 3UTR 100% 4.950 3.465 N DIO2 n/a
8 TRCN0000084066 CAGGTGAAATTGGGTGAGGAT pLKO.1 494 3UTR 100% 2.640 1.848 N DIO2 n/a
9 TRCN0000084067 TGAGGTGAAGAAGCACCAGAA pLKO.1 814 3UTR 100% 4.050 2.430 N DIO2 n/a
10 TRCN0000286959 TGAGGTGAAGAAGCACCAGAA pLKO_005 814 3UTR 100% 4.050 2.430 N DIO2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_158991.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13844 pDONR223 100% 13% None (many diffs) n/a
2 ccsbBroad304_13844 pLX_304 0% 13% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000476920 AGGATACCTACAGGCATTCCCACC pLX_317 34.5% 13% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV