Construct: ORF TRCN0000476941
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003245.1_s317c1
- Derived from:
- ccsbBroadEn_12904
- DNA Barcode:
- CGAATCGGTGTTAGCTGGCTTATG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- REPS1 (85021)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476941
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 85021 | REPS1 | RALBP1 associated Eps domai... | NM_001286612.1 | 92.6% | 92.6% | 1_156del |
| 2 | human | 85021 | REPS1 | RALBP1 associated Eps domai... | XM_017011389.1 | 90.1% | 90.1% | 1_21del;1311_1502del |
| 3 | human | 85021 | REPS1 | RALBP1 associated Eps domai... | XM_011536202.2 | 86.9% | 86.9% | 1_21del;1123_1203del;1392_1583del |
| 4 | human | 85021 | REPS1 | RALBP1 associated Eps domai... | XM_005267179.4 | 85% | 85% | 1_156del;1446_1634del |
| 5 | human | 85021 | REPS1 | RALBP1 associated Eps domai... | NM_001128617.2 | 84.9% | 84.9% | 1_156del;1446_1637del |
| 6 | human | 85021 | REPS1 | RALBP1 associated Eps domai... | XM_017011387.2 | 82.2% | 82.2% | 1_156del;1258_1335del;1524_1712del |
| 7 | human | 85021 | REPS1 | RALBP1 associated Eps domai... | NM_031922.4 | 82.1% | 82.1% | 1_156del;1258_1338del;1527_1715del |
| 8 | human | 85021 | REPS1 | RALBP1 associated Eps domai... | XM_005267177.4 | 82.1% | 82.1% | 1_156del;1258_1335del;1524_1715del |
| 9 | human | 85021 | REPS1 | RALBP1 associated Eps domai... | NM_001286611.1 | 82% | 82% | 1_156del;1258_1338del;1527_1718del |
| 10 | human | 85021 | REPS1 | RALBP1 associated Eps domai... | XM_017011388.2 | 80.9% | 78.6% | (many diffs) |
| 11 | human | 85021 | REPS1 | RALBP1 associated Eps domai... | XM_005267178.5 | 76.4% | 74.2% | (many diffs) |
| 12 | mouse | 19707 | Reps1 | RalBP1 associated Eps domai... | NM_001111065.1 | 76.1% | 80.4% | (many diffs) |
| 13 | mouse | 19707 | Reps1 | RalBP1 associated Eps domai... | XM_017313852.1 | 73.6% | 77.8% | (many diffs) |
| 14 | mouse | 19707 | Reps1 | RalBP1 associated Eps domai... | NM_009048.2 | 73.5% | 77.7% | (many diffs) |
| 15 | mouse | 19707 | Reps1 | RalBP1 associated Eps domai... | XM_017313853.1 | 73.4% | 77.8% | (many diffs) |
| 16 | mouse | 19707 | Reps1 | RalBP1 associated Eps domai... | XM_006512621.2 | 70.9% | 75.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2025
- ORF length:
- 1959
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gctttgtggt gcaacaagac ttggttattt tggaagaagt cagttctaca 121 ttgctttgaa acttgtagct gttgcccagt ctggtttccc tttaagagtg gaaagtataa 181 atacagtaaa ggaccttcct ctgccaagat ttgttgcttc aaagaatgaa caggaatctc 241 gccatgcagc ctcatattct tcagattctg aaaatcaagg gtcgtattct ggtgtaattc 301 ccccaccacc tggcaggggg caagtgaaaa agggatccgt aagccatgat acggttcagc 361 ctcgtacatc tgcagatgca caggaacctg catccccagt agtttcacca cagcaatccc 421 caccaacttc tccacacaca tggaggaagc acagccgtca tcccagcggt gggaatagtg 481 agaggcctct cgcgggacct gggccatttt ggtctccctt tggtgaagca caatcaggtt 541 cttctgctgg tgatgcagtg tggtcagggc attccccacc tccacctcaa gaaaactggg 601 tcagttttgc agatactcca ccaaccagta ctcttttaac catgcatcct gcttctgtcc 661 aggaccagac aacagtacga actgtagcat cagctacaac tgccattgaa attcgtaggc 721 aatccagtag ttatgatgat ccctggaaaa taacagatga acaaagacag tattatgtaa 781 atcagtttaa aaccattcag cctgatctaa acggatttat tccaggatct gcagctaaag 841 agttttttac aaaatcaaaa cttcctattc ttgaactttc tcatatttgg gaactctcag 901 actttgataa agatggtgca ttgacactgg atgagttttg tgctgctttt catctggtgg 961 ttgctaggaa gaatggctat gatttaccag aaaaacttcc tgaaagctta atgcccaaac 1021 tgattgattt ggaagattca gcagatgttg gggatcagcc aggtgaggta ggttattcag 1081 gctctcctgc tgaagctcct ccaagcaagt caccatcgat gccatcacta aaccagacat 1141 ggcctgagct gaatcagagc agtgaggata ctgctattgt tcatccagtt cccattcgta 1201 tgactccaag caaaatccac atgcaggaaa tggaacttaa aagaactggc agcgatcata 1261 caaatcccac tagcccatta cttgtgaaac catctgacct tttagaagaa aataagataa 1321 attcatcggt gaaattcgct tctggtaata ctgtaggaca acaacaggct ggagttgttg 1381 cccatcctcc tgcagtgcct ccaagaccac agccctcaca ggctcctggt cctgctgtgc 1441 atcgcccagt ggatgccgat ggcctcataa ctcacactag tacctcacct cagcagatac 1501 cagagcaacc aaattttgca gatttcagtc agtttgaagt atttgctgca tcaaatgtaa 1561 acgacgaaca agatgatgaa gccgagaaac atccagaagt cctgccggct gaaaaagctt 1621 ctgatcctgc aagttctctt cgagttgcca aaaCAGATAG TAAAACTGAA GAAAAGACAG 1681 CTGCTAGTGC TCCTGCCAAT GTGAGCAAAG GCACAACACC ACTTGCTCCA CCACCTAAAC 1741 CTGTTCGAAG AAGATTAAAA TCAGAAGATG AATTAAGGCC AGAAGTTGAT GAACATACAC 1801 AAAAGACGGG TGTCTTAGCT GCTGTTCTTG CATCACAACC TTCTATTCCC AGATCTGTTG 1861 GGAAAGATAA GAAAGCTATT CAGGCATCAA TTAGACGTAA TAAGGAAACC AACACCGTTT 1921 TGGCCAGATT GAATAGCGAA TTGCAGCAAC AATTAAAGGA TGTTCTTGAG GAGAGAATTT 1981 CCCTGGAAGT TCAACTGGAA CAACTTCGAC CATTCTCTCA CCTATACCCA ACTTTCTTGT 2041 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 2101 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 2161 GAAAGGACGA CGAATCGGTG TTAGCTGGCT TATGACGCGT TAAGTCgaca atcaacctct 2221 ggattacaaa atttgtgaaa gatt