Transcript: Mouse XM_017313852.1

PREDICTED: Mus musculus RalBP1 associated Eps domain containing protein (Reps1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Reps1 (19707)
Length:
3048
CDS:
468..2852

Additional Resources:

NCBI RefSeq record:
XM_017313852.1
NBCI Gene record:
Reps1 (19707)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313852.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249103 CGTAGGCAATCCAGTAGTTAT pLKO_005 1272 CDS 100% 13.200 18.480 N Reps1 n/a
2 TRCN0000201647 CCCACGATTTGTTGCTTCAAA pLKO.1 761 CDS 100% 5.625 4.500 N Reps1 n/a
3 TRCN0000249102 GCCTGACCTAAACGGATTTAT pLKO_005 1358 CDS 100% 15.000 10.500 N Reps1 n/a
4 TRCN0000217553 GGCATCCATTAGACGAAATAA pLKO.1 2708 CDS 100% 15.000 10.500 N Reps1 n/a
5 TRCN0000249104 GGCATCCATTAGACGAAATAA pLKO_005 2708 CDS 100% 15.000 10.500 N Reps1 n/a
6 TRCN0000249101 TGGATGCAGATGGTCTAATAA pLKO_005 2275 CDS 100% 15.000 10.500 N Reps1 n/a
7 TRCN0000249100 TGTGAACGTGCCCATTCTTAA pLKO_005 2868 3UTR 100% 13.200 9.240 N Reps1 n/a
8 TRCN0000192613 GCAGATTTCAGCCAATTTGAA pLKO.1 2343 CDS 100% 5.625 3.938 N Reps1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313852.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12905 pDONR223 100% 84.1% 88.3% None (many diffs) n/a
2 ccsbBroad304_12905 pLX_304 0% 84.1% 88.3% V5 (many diffs) n/a
3 TRCN0000474307 ATTCAAACGGAAAATAATATACGT pLX_317 18.1% 84.1% 88.3% V5 (many diffs) n/a
4 ccsbBroadEn_12904 pDONR223 100% 73.6% 77.8% None (many diffs) n/a
5 ccsbBroad304_12904 pLX_304 0% 73.6% 77.8% V5 (many diffs) n/a
6 TRCN0000476941 CGAATCGGTGTTAGCTGGCTTATG pLX_317 19.3% 73.6% 77.8% V5 (many diffs) n/a
Download CSV