Construct: ORF TRCN0000477021
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002890.1_s317c1
- Derived from:
- ccsbBroadEn_08593
- DNA Barcode:
- GATGTACTTGATTATTTGTGTAAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RNF130 (55819)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477021
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55819 | RNF130 | ring finger protein 130 | NM_018434.6 | 99.7% | 99.7% | 45C>A;108G>A;772G>T |
| 2 | human | 55819 | RNF130 | ring finger protein 130 | XM_011534593.3 | 93.7% | 89.8% | (many diffs) |
| 3 | human | 55819 | RNF130 | ring finger protein 130 | NM_001280801.2 | 91.4% | 91.1% | (many diffs) |
| 4 | human | 55819 | RNF130 | ring finger protein 130 | XM_024446129.1 | 89.1% | 86.8% | (many diffs) |
| 5 | mouse | 59044 | Rnf130 | ring finger protein 130 | NM_021540.4 | 92.9% | 97.8% | (many diffs) |
| 6 | mouse | 59044 | Rnf130 | ring finger protein 130 | NM_001290750.1 | 85.4% | 87.7% | (many diffs) |
| 7 | mouse | 59044 | Rnf130 | ring finger protein 130 | NM_001290749.1 | 84.7% | 89.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1326
- ORF length:
- 1257
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gagctgcgcg gggcgggcgg gccctgcccg gctcgccgcg ctagccctgc 121 tgacctgcag cctgtggccg gcacgggcag acaacgcgag ccaggagtac tacacagcgc 181 tcatcaacgt gacggtgcag gagcccggcc gcggcgcccc gctcacgttt cgcatcgacc 241 gcgggcgcta cgggcttgac tcccccaagg ccgaggtccg cggccaggtg ctggcgccgc 301 tgcccctcca cggagttgct gatcatctgg gctgtgatcc acaaacccgg ttctttgtcc 361 ctcctaatat caaacagtgg attgccttgc tgcagagggg aaactgcacg tttaaagaga 421 aaatatcacg ggccgctttc cacaatgcag ttgctgtagt catctacaat aataaatcca 481 aagaggagcc agttaccatg actcatccag gcactggaga tattattgct gtcatgataa 541 cagaattgag gggtaaggat attttgagtt atctggagaa aaacatctct gtacaaatga 601 caatagctgt tggaactcga atgccaccga agaacttcag ccgtggctct ctagtcttcg 661 tgtcaatatc ctttattgtt ttgatgatta tttcttcagc atggctcata ttctacttca 721 ttcagaagat caggtacaca aatgcacgcg acaggaacca gcgtcgtctc ggagatgcag 781 ccaagaaagc catcagtaaa ttgacaacca ggacagtaaa gaagggtgac aaggaaactt 841 acccagactt tgatcattgt gcagtctgca tagagagcta taagcagaat gatgtcgtcc 901 gaattctccc ctgcaagcat gttttccaca aaTCCTGCGT GGATCCCTGG CTTAGTGAAC 961 ATTGTACCTG TCCTATGTGC AAACTTAATA TATTGAAGGC CCTGGGAATT GTGCCGAATT 1021 TGCCATGTAC TGATAACGTA GCATTCGATA TGGAAAGGCT CACCAGAACC CAAGCTGTTA 1081 ACCGAAGATC AGCCCTCGGC GACCTCGCCG GCGACAACTC CCTTGGCCTT GAGCCACTTC 1141 GAACTTCGGG GATCTCACCT CTTCCTCAGG ATGGGGAGCT CACTCCGAGA ACAGGAGAAA 1201 TCAACATTGC AGTAACAAAA GAATGGTTTA TTATTGCCAG TTTTGGCCTC CTCAGTGCCC 1261 TCACACTCTG CTACATGATC ATCAGAGCCA CAGCTAGCTT GAATGCTAAT GAGGTAGAAT 1321 GGTTTTTGCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1381 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1441 CTTGGCTTTA TATATCTTGT GGAAAGGACG AGATGTACTT GATTATTTGT GTAAAACGCG 1501 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt