Construct: ORF TRCN0000477154
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016785.1_s317c1
- Derived from:
- ccsbBroadEn_12606
- DNA Barcode:
- GTAGAGTCCTTCGTTGACGGTCCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KCTD17 (79734)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477154
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 79734 | KCTD17 | potassium channel tetrameri... | NM_024681.3 | 97.5% | 97.6% | 1_21del;426C>T |
| 2 | human | 79734 | KCTD17 | potassium channel tetrameri... | NM_001282684.1 | 90.2% | 90.3% | 1_21del;426C>T;732_803del |
| 3 | human | 79734 | KCTD17 | potassium channel tetrameri... | XM_005261743.3 | 85.7% | 82.7% | (many diffs) |
| 4 | human | 79734 | KCTD17 | potassium channel tetrameri... | XM_005261742.3 | 79.8% | 77.1% | (many diffs) |
| 5 | human | 79734 | KCTD17 | potassium channel tetrameri... | XM_005261741.3 | 77.6% | 69.5% | (many diffs) |
| 6 | human | 79734 | KCTD17 | potassium channel tetrameri... | XM_005261744.2 | 75% | 76.7% | (many diffs) |
| 7 | human | 79734 | KCTD17 | potassium channel tetrameri... | XM_011530377.2 | 73.7% | 63.1% | (many diffs) |
| 8 | human | 79734 | KCTD17 | potassium channel tetrameri... | NM_001282685.1 | 73.2% | 69% | (many diffs) |
| 9 | human | 79734 | KCTD17 | potassium channel tetrameri... | NM_001282686.1 | 71.6% | 68.6% | (many diffs) |
| 10 | human | 79734 | KCTD17 | potassium channel tetrameri... | XM_011530374.2 | 65.7% | 60.4% | (many diffs) |
| 11 | human | 79734 | KCTD17 | potassium channel tetrameri... | XR_937917.2 | 43.3% | (many diffs) | |
| 12 | human | 79734 | KCTD17 | potassium channel tetrameri... | XR_001755296.1 | 40.6% | (many diffs) | |
| 13 | mouse | 72844 | Kctd17 | potassium channel tetrameri... | XM_006521461.3 | 71% | 68.9% | (many diffs) |
| 14 | mouse | 72844 | Kctd17 | potassium channel tetrameri... | NM_001289671.1 | 67% | 69% | (many diffs) |
| 15 | mouse | 72844 | Kctd17 | potassium channel tetrameri... | XM_006521460.3 | 67% | 63.3% | (many diffs) |
| 16 | mouse | 72844 | Kctd17 | potassium channel tetrameri... | NM_001289672.1 | 66.4% | 66.3% | (many diffs) |
| 17 | mouse | 72844 | Kctd17 | potassium channel tetrameri... | NM_001289673.1 | 63.5% | 65.9% | (many diffs) |
| 18 | mouse | 72844 | Kctd17 | potassium channel tetrameri... | NR_110357.1 | 43.3% | (many diffs) | |
| 19 | mouse | 72844 | Kctd17 | potassium channel tetrameri... | XR_001781569.1 | 37.4% | (many diffs) | |
| 20 | mouse | 72844 | Kctd17 | potassium channel tetrameri... | XR_001781568.1 | 36.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 936
- ORF length:
- 870
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag gatggaggcc ggggaggcag cgccgccggc gggggcgggc ggccgcgccg 121 caggcggctg gggcaagtgg gtgcggctca acgtgggggg cacggtgttc ctgaccaccc 181 ggcagacgct gtgccgcgag cagaagtcct tcctcagccg cctgtgccag ggggaagagc 241 tgcagtcgga ccgggatgag accggggcct acctcattga ccgtgacccc acctacttcg 301 ggcccatcct gaacttcctc cggcatggca agctggtgct ggacaaggac atggctgagg 361 agggggtcct ggaggaagcc gagttctaca acatcggccc gctgatccgc atcatcaaag 421 accggatgga agagaaggac tacacggtca cccaggtccc acccaagcat gtgtaccgcg 481 tgctgcagtg ccaggaggag gagctcacgc aaatggtctc caccatgtct gatggctggc 541 gcttcgagca gctggtgaac atcggctcct cctacaacta cggcagcgag gaccaggcag 601 agttcctgtg tgtggtgtcc aaggagcTCC ACAGCACCCC AAACGGGCTG AGCTCAGAGT 661 CCAGCCGCAA AACCAAGAGC ACGGAGGAGC AGCTGGAGGA GCAGCAGCAG CAGGAGGAGG 721 AGGTGGAGGA GGTGGAGGTG GAACAGGTGC AGGTGGAGGC AGATGCACAG GAGAAAGGTT 781 CCCGTCCGCA CCCTCTCAGA CCTGAGGCTG AGCTTGCAGT GAGGGCTTCT CCTCGGCCCC 841 TCGCCCGCCC CCAGAGCTGC CATCCCTGCT GTTACAAGCC AGAGGCACCC GGATGTGAGG 901 CCCCAGATCA CCTCCAGGGA CTTGGGGTTC CCATCTGCCC AACTTTCTTG TACAAAGTGG 961 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1021 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1081 AGTAGAGTCC TTCGTTGACG GTCCAACGCG TTAAGTCgac aatcaacctc tggattacaa 1141 aatttgtgaa agatt