Transcript: Mouse NM_001289671.1

Mus musculus potassium channel tetramerisation domain containing 17 (Kctd17), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-16
Taxon:
Mus musculus (mouse)
Gene:
Kctd17 (72844)
Length:
1707
CDS:
95..847

Additional Resources:

NCBI RefSeq record:
NM_001289671.1
NBCI Gene record:
Kctd17 (72844)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289671.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253497 TCAGGGCGAAGAGCTTCAATC pLKO_005 277 CDS 100% 10.800 8.640 N Kctd17 n/a
2 TRCN0000253495 CTCTGATTCGAATCATCAAAG pLKO_005 450 CDS 100% 10.800 7.560 N Kctd17 n/a
3 TRCN0000253498 GTGGCACTACCTACCCATATC pLKO_005 1156 3UTR 100% 10.800 7.560 N Kctd17 n/a
4 TRCN0000253496 GGTGCCACCTAAGCATGTATA pLKO_005 505 CDS 100% 13.200 7.920 N Kctd17 n/a
5 TRCN0000253499 TTCCGATCTGAAATCCTTTAT pLKO_005 950 3UTR 100% 13.200 7.920 N Kctd17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289671.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000472221 AAGCCTCCGGTCCTAGTCTTCTAG pLX_317 54.5% 74.2% 75.1% V5 (many diffs) n/a
2 ccsbBroadEn_15988 pDONR223 0% 74.2% 75.1% None (many diffs) n/a
3 ccsbBroad304_15988 pLX_304 0% 74.2% 75.1% V5 (many diffs) n/a
4 ccsbBroadEn_14270 pDONR223 98.5% 68.1% 64% None (many diffs) n/a
5 ccsbBroad304_14270 pLX_304 0% 68.1% 64% V5 (many diffs) n/a
6 TRCN0000470392 TCTGCGCGATATGTCTGATCTCAC pLX_317 54.6% 68.1% 64% V5 (many diffs) n/a
7 ccsbBroadEn_12606 pDONR223 100% 67% 69% None (many diffs) n/a
8 ccsbBroad304_12606 pLX_304 0% 67% 69% V5 (many diffs) n/a
9 TRCN0000477154 GTAGAGTCCTTCGTTGACGGTCCA pLX_317 35.8% 67% 69% V5 (many diffs) n/a
Download CSV